Incidental Mutation 'IGL03097:Dsc3'
ID 453240
Institutional Source Beutler Lab
Gene Symbol Dsc3
Ensembl Gene ENSMUSG00000059898
Gene Name desmocollin 3
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # IGL03097 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 19960930-20002351 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19974048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 505 (N505K)
Ref Sequence ENSEMBL: ENSMUSP00000153261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]
AlphaFold P55850
Predicted Effect probably benign
Transcript: ENSMUST00000115848
AA Change: N505K

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: N505K

DomainStartEndE-ValueType
Cadherin_pro 31 113 9.08e-41 SMART
CA 156 241 4.99e-11 SMART
CA 265 353 7.79e-22 SMART
CA 376 471 2.66e-6 SMART
CA 494 576 4.58e-19 SMART
CA 595 677 3.02e-2 SMART
transmembrane domain 692 714 N/A INTRINSIC
Pfam:Cadherin_C 778 895 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225110
AA Change: N505K

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
Meta Mutation Damage Score 0.3171 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Ak5 A G 3: 152,660,514 probably null Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Cyp39a1 T A 17: 43,683,050 Y200* probably null Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gstm3 T C 3: 107,968,801 D25G probably benign Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Map3k2 T G 18: 32,200,017 D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Ms4a1 G T 19: 11,253,192 T215N probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pde6c A G 19: 38,178,271 T720A probably damaging Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Dsc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dsc3 APN 18 19985631 missense probably null 1.00
IGL01978:Dsc3 APN 18 19974196 missense possibly damaging 0.79
IGL02101:Dsc3 APN 18 20001906 missense probably benign 0.01
IGL02165:Dsc3 APN 18 19983652 missense probably benign 0.06
IGL02543:Dsc3 APN 18 19965828 missense probably benign 0.11
IGL02970:Dsc3 APN 18 19968260 missense probably damaging 1.00
R0133:Dsc3 UTSW 18 19971582 missense probably damaging 0.96
R0304:Dsc3 UTSW 18 19981241 missense probably damaging 1.00
R0360:Dsc3 UTSW 18 19971582 missense possibly damaging 0.79
R0673:Dsc3 UTSW 18 19989590 missense probably damaging 1.00
R0826:Dsc3 UTSW 18 19981172 missense probably damaging 0.99
R1120:Dsc3 UTSW 18 19986977 missense probably benign 0.05
R1491:Dsc3 UTSW 18 19987034 missense probably damaging 0.99
R1667:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R1688:Dsc3 UTSW 18 19966227 missense probably damaging 1.00
R1792:Dsc3 UTSW 18 19986998 missense probably damaging 1.00
R1858:Dsc3 UTSW 18 19965716 missense probably damaging 0.97
R1965:Dsc3 UTSW 18 19980672 missense probably damaging 1.00
R1988:Dsc3 UTSW 18 19965846 missense possibly damaging 0.86
R2049:Dsc3 UTSW 18 19989680 missense possibly damaging 0.65
R2127:Dsc3 UTSW 18 19968354 missense probably benign 0.00
R2143:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2144:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2148:Dsc3 UTSW 18 19965638 missense probably damaging 0.99
R3038:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R3872:Dsc3 UTSW 18 19971508 missense probably damaging 0.99
R4229:Dsc3 UTSW 18 19965821 missense probably damaging 1.00
R4298:Dsc3 UTSW 18 19980754 missense possibly damaging 0.62
R4491:Dsc3 UTSW 18 20001865 missense probably benign 0.30
R4590:Dsc3 UTSW 18 19989695 missense probably damaging 1.00
R4615:Dsc3 UTSW 18 19971488 missense possibly damaging 0.67
R5316:Dsc3 UTSW 18 19963541 missense possibly damaging 0.67
R5758:Dsc3 UTSW 18 19989534 missense probably damaging 1.00
R5796:Dsc3 UTSW 18 19971501 missense probably benign 0.01
R5916:Dsc3 UTSW 18 19987020 missense probably damaging 1.00
R6022:Dsc3 UTSW 18 19966338 missense probably damaging 0.97
R6233:Dsc3 UTSW 18 19965795 missense possibly damaging 0.77
R6351:Dsc3 UTSW 18 19966291 missense probably benign 0.05
R6971:Dsc3 UTSW 18 19966218 critical splice donor site probably null
R7261:Dsc3 UTSW 18 19980757 nonsense probably null
R7442:Dsc3 UTSW 18 19981156 missense probably damaging 1.00
R7795:Dsc3 UTSW 18 19966231 missense probably damaging 1.00
R8051:Dsc3 UTSW 18 19981213 missense probably damaging 1.00
R8531:Dsc3 UTSW 18 19968392 missense probably benign
R8531:Dsc3 UTSW 18 19981217 missense probably damaging 1.00
R8872:Dsc3 UTSW 18 19989622 missense probably benign 0.02
R8927:Dsc3 UTSW 18 19974177 missense probably benign
R8928:Dsc3 UTSW 18 19974177 missense probably benign
R9140:Dsc3 UTSW 18 19989559 missense probably benign 0.01
R9493:Dsc3 UTSW 18 19989695 nonsense probably null
X0061:Dsc3 UTSW 18 19989627 missense probably damaging 1.00
Z1177:Dsc3 UTSW 18 19966315 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCTTCAATGCTGACCCAG -3'
(R):5'- CGTCAAGTGACCCTAGAGATTG -3'

Sequencing Primer
(F):5'- AATGCTGACCCAGTCTTTAGG -3'
(R):5'- GGTGTGAACAACGAAGCTCCATTC -3'
Posted On 2017-01-31