Incidental Mutation 'IGL03097:Map3k2'
ID 453241
Institutional Source Beutler Lab
Gene Symbol Map3k2
Ensembl Gene ENSMUSG00000024383
Gene Name mitogen-activated protein kinase kinase kinase 2
Synonyms MEK kinase 2, Mekk2, 9630061B06Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03097 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 32163089-32236751 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 32200017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 81 (D81E)
Ref Sequence ENSEMBL: ENSMUSP00000094326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096575]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000096575
AA Change: D81E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000094326
Gene: ENSMUSG00000024383
AA Change: D81E

DomainStartEndE-ValueType
PB1 43 122 6.96e-20 SMART
low complexity region 203 219 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
S_TKc 356 616 2.86e-92 SMART
Meta Mutation Damage Score 0.4118 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase preferentially activates other kinases involved in the MAP kinase signaling pathway. This kinase has been shown to directly phosphorylate and activate Ikappa B kinases, and thus plays a role in NF-kappa B signaling pathway. This kinase has also been found to bind and activate protein kinase C-related kinase 2, which suggests its involvement in a regulated signaling process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Ak5 A G 3: 152,660,514 probably null Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Cyp39a1 T A 17: 43,683,050 Y200* probably null Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Dsc3 A T 18: 19,974,048 N505K probably benign Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gstm3 T C 3: 107,968,801 D25G probably benign Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Ms4a1 G T 19: 11,253,192 T215N probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pde6c A G 19: 38,178,271 T720A probably damaging Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Map3k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Map3k2 APN 18 32228239 missense probably benign 0.00
IGL00774:Map3k2 APN 18 32228239 missense probably benign 0.00
IGL01993:Map3k2 APN 18 32226631 nonsense probably null
IGL02043:Map3k2 APN 18 32207534 missense probably damaging 1.00
IGL02314:Map3k2 APN 18 32218500 splice site probably benign
IGL02441:Map3k2 APN 18 32200046 splice site probably benign
IGL03350:Map3k2 APN 18 32212148 missense probably damaging 0.98
PIT4434001:Map3k2 UTSW 18 32210035 missense possibly damaging 0.51
R0086:Map3k2 UTSW 18 32218468 missense probably damaging 1.00
R0374:Map3k2 UTSW 18 32212173 splice site probably null
R0445:Map3k2 UTSW 18 32217210 missense probably damaging 0.96
R1158:Map3k2 UTSW 18 32217158 missense probably benign 0.00
R1415:Map3k2 UTSW 18 32228277 missense possibly damaging 0.82
R1667:Map3k2 UTSW 18 32203792 splice site probably benign
R1926:Map3k2 UTSW 18 32203110 missense probably damaging 0.99
R3795:Map3k2 UTSW 18 32226648 missense probably benign 0.00
R4607:Map3k2 UTSW 18 32199977 missense probably damaging 1.00
R4793:Map3k2 UTSW 18 32228150 missense probably damaging 1.00
R5332:Map3k2 UTSW 18 32207456 missense probably damaging 0.98
R5492:Map3k2 UTSW 18 32228136 missense probably damaging 1.00
R6008:Map3k2 UTSW 18 32203051 missense probably damaging 1.00
R6317:Map3k2 UTSW 18 32203033 missense probably damaging 1.00
R6356:Map3k2 UTSW 18 32211970 missense probably damaging 1.00
R6841:Map3k2 UTSW 18 32226629 missense probably benign 0.12
R6928:Map3k2 UTSW 18 32207540 critical splice donor site probably null
R7475:Map3k2 UTSW 18 32199962 missense possibly damaging 0.61
R7696:Map3k2 UTSW 18 32220594 missense probably benign 0.00
R8774:Map3k2 UTSW 18 32212064 missense probably damaging 1.00
R8774-TAIL:Map3k2 UTSW 18 32212064 missense probably damaging 1.00
R9103:Map3k2 UTSW 18 32220572 missense possibly damaging 0.91
R9282:Map3k2 UTSW 18 32209752 missense probably damaging 0.99
R9800:Map3k2 UTSW 18 32200016 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCAGTCTATTACACACATGCACAG -3'
(R):5'- TCTTAGCTATGTGCACAGTAGC -3'

Sequencing Primer
(F):5'- GATTTAAACACTCTCCTAAGTAGCAC -3'
(R):5'- GTAGCACCCCACTTAACAGTAAAATC -3'
Posted On 2017-01-31