Incidental Mutation 'IGL03097:Ms4a1'
ID 453243
Institutional Source Beutler Lab
Gene Symbol Ms4a1
Ensembl Gene ENSMUSG00000024673
Gene Name membrane-spanning 4-domains, subfamily A, member 1
Synonyms Ly-44, Cd20
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03097 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 11249675-11266241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 11253192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 215 (T215N)
Ref Sequence ENSEMBL: ENSMUSP00000126422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169159]
AlphaFold P19437
Predicted Effect probably benign
Transcript: ENSMUST00000169159
AA Change: T215N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126422
Gene: ENSMUSG00000024673
AA Change: T215N

DomainStartEndE-ValueType
Pfam:CD20 44 210 3.8e-48 PFAM
low complexity region 253 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187379
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus affects B cell physiology but does not impair B cell development or overall immune function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Ak5 A G 3: 152,660,514 probably null Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Cyp39a1 T A 17: 43,683,050 Y200* probably null Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Dsc3 A T 18: 19,974,048 N505K probably benign Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gstm3 T C 3: 107,968,801 D25G probably benign Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Map3k2 T G 18: 32,200,017 D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pde6c A G 19: 38,178,271 T720A probably damaging Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Ms4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ms4a1 APN 19 11254559 missense probably benign 0.17
bilious UTSW 19 11253178 critical splice donor site probably null
Chartreuse UTSW 19 11258248 missense probably damaging 1.00
Paris_green UTSW 19 11256569 splice site probably null
R0437:Ms4a1 UTSW 19 11256569 splice site probably null
R0518:Ms4a1 UTSW 19 11258679 splice site probably null
R0521:Ms4a1 UTSW 19 11258679 splice site probably null
R0704:Ms4a1 UTSW 19 11253232 missense probably benign 0.01
R1532:Ms4a1 UTSW 19 11253193 missense probably benign
R4877:Ms4a1 UTSW 19 11254493 missense probably damaging 0.99
R5089:Ms4a1 UTSW 19 11258812 missense probably benign 0.01
R5903:Ms4a1 UTSW 19 11258248 missense probably damaging 1.00
R5981:Ms4a1 UTSW 19 11251816 missense probably benign 0.02
R6366:Ms4a1 UTSW 19 11258698 missense probably damaging 1.00
R6805:Ms4a1 UTSW 19 11253173 splice site probably null
R6864:Ms4a1 UTSW 19 11253178 critical splice donor site probably null
R8985:Ms4a1 UTSW 19 11254691 missense probably benign 0.00
R9052:Ms4a1 UTSW 19 11256590 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATATTTGCTGCCACTGCTGG -3'
(R):5'- GCACTGAACTGAACTGTTGC -3'

Sequencing Primer
(F):5'- GCTGCCACTGCTGGTGTTTTC -3'
(R):5'- ACTGAACTGAACTGTTGCTCTCTGAG -3'
Posted On 2017-01-31