Incidental Mutation 'IGL03097:Pde6c'
ID453244
Institutional Source Beutler Lab
Gene Symbol Pde6c
Ensembl Gene ENSMUSG00000024992
Gene Namephosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonymscpfl1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #IGL03097 (G1)
Quality Score157
Status Validated
Chromosome19
Chromosomal Location38132781-38183958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38178271 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 720 (T720A)
Ref Sequence ENSEMBL: ENSMUSP00000107948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025956] [ENSMUST00000112329]
Predicted Effect probably damaging
Transcript: ENSMUST00000025956
AA Change: T720A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025956
Gene: ENSMUSG00000024992
AA Change: T720A

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 7.57e-9 SMART
low complexity region 827 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112329
AA Change: T720A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107948
Gene: ENSMUSG00000024992
AA Change: T720A

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 1.62e-8 SMART
low complexity region 802 811 N/A INTRINSIC
Meta Mutation Damage Score 0.6870 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-prime subunit of cone phosphodiesterase, which is composed of a homodimer of two alpha-prime subunits and 3 smaller proteins of 11, 13, and 15 kDa. Mutations in this gene are associated with cone dystrophy type 4 (COD4). [provided by RefSeq, Mar 2010]
PHENOTYPE: A spontaneous mutation in this gene results in abnormal cone photoreceptor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Ak5 A G 3: 152,660,514 probably null Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Cyp39a1 T A 17: 43,683,050 Y200* probably null Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Dsc3 A T 18: 19,974,048 N505K probably benign Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gstm3 T C 3: 107,968,801 D25G probably benign Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Map3k2 T G 18: 32,200,017 D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Ms4a1 G T 19: 11,253,192 T215N probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Pde6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Pde6c APN 19 38162876 splice site probably benign
IGL01333:Pde6c APN 19 38175695 missense probably benign 0.05
IGL01390:Pde6c APN 19 38161928 missense probably benign 0.01
IGL02508:Pde6c APN 19 38157500 missense probably benign 0.13
IGL02542:Pde6c APN 19 38178130 missense probably damaging 1.00
IGL02546:Pde6c APN 19 38140040 missense probably benign 0.00
IGL02661:Pde6c APN 19 38180800 missense probably damaging 0.97
silverton UTSW 19 38162845 missense probably damaging 1.00
R0117:Pde6c UTSW 19 38151531 missense probably damaging 1.00
R0128:Pde6c UTSW 19 38169365 splice site probably benign
R0349:Pde6c UTSW 19 38162349 missense probably damaging 1.00
R0612:Pde6c UTSW 19 38133246 missense probably benign 0.03
R0692:Pde6c UTSW 19 38180250 missense probably damaging 0.99
R0785:Pde6c UTSW 19 38133180 missense probably benign
R1605:Pde6c UTSW 19 38141492 missense probably damaging 1.00
R1643:Pde6c UTSW 19 38161958 missense possibly damaging 0.56
R1694:Pde6c UTSW 19 38180225 missense probably damaging 1.00
R1781:Pde6c UTSW 19 38151698 missense possibly damaging 0.69
R1900:Pde6c UTSW 19 38161940 missense probably damaging 1.00
R1944:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R1945:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R2143:Pde6c UTSW 19 38162329 missense probably damaging 1.00
R2497:Pde6c UTSW 19 38153694 missense probably damaging 1.00
R3737:Pde6c UTSW 19 38140224 missense probably damaging 1.00
R4010:Pde6c UTSW 19 38169436 missense probably damaging 1.00
R4241:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4242:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4259:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4661:Pde6c UTSW 19 38169439 missense probably damaging 1.00
R4677:Pde6c UTSW 19 38157385 missense probably damaging 1.00
R4708:Pde6c UTSW 19 38180893 missense possibly damaging 0.92
R4889:Pde6c UTSW 19 38133151 missense probably benign 0.23
R4898:Pde6c UTSW 19 38150624 missense possibly damaging 0.81
R4941:Pde6c UTSW 19 38151565 missense probably damaging 1.00
R5448:Pde6c UTSW 19 38133175 missense probably damaging 1.00
R6174:Pde6c UTSW 19 38140229 missense possibly damaging 0.57
R6249:Pde6c UTSW 19 38158560 critical splice donor site probably null
R6270:Pde6c UTSW 19 38158436 missense probably damaging 1.00
R7183:Pde6c UTSW 19 38133090 missense probably benign 0.00
R7428:Pde6c UTSW 19 38157536 critical splice donor site probably null
R7429:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7430:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7643:Pde6c UTSW 19 38141421 missense probably damaging 1.00
R7793:Pde6c UTSW 19 38159753 missense possibly damaging 0.94
R7811:Pde6c UTSW 19 38140059 missense possibly damaging 0.91
R8097:Pde6c UTSW 19 38161966 nonsense probably null
Z1176:Pde6c UTSW 19 38132881 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTGCGAGCAGATGCAAAGTG -3'
(R):5'- TGACTCTGTACTTCCCAGGG -3'

Sequencing Primer
(F):5'- TGCAAAGTGAAGAAGAAACCATC -3'
(R):5'- TTGGTGATGGCAGACAGGTCAC -3'
Posted On2017-01-31