Incidental Mutation 'IGL02984:Slc35f5'
ID453253
Institutional Source Beutler Lab
Gene Symbol Slc35f5
Ensembl Gene ENSMUSG00000026342
Gene Namesolute carrier family 35, member F5
Synonyms1300003P13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #IGL02984 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125560595-125595820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125562513 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 71 (Y71N)
Ref Sequence ENSEMBL: ENSMUSP00000139639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027580] [ENSMUST00000190037]
Predicted Effect probably benign
Transcript: ENSMUST00000027580
AA Change: Y49N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027580
Gene: ENSMUSG00000026342
AA Change: Y49N

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
transmembrane domain 69 86 N/A INTRINSIC
transmembrane domain 101 120 N/A INTRINSIC
Pfam:EamA 226 317 2.1e-8 PFAM
transmembrane domain 329 348 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 397 419 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190037
AA Change: Y71N

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139639
Gene: ENSMUSG00000026342
AA Change: Y71N

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 123 142 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,803 I473N probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A530064D06Rik T C 17: 48,163,280 I178V probably benign Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Aldh1l2 G A 10: 83,527,335 P55S probably damaging Het
Bglap3 T C 3: 88,368,791 T85A possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csrnp3 A G 2: 66,022,209 D315G probably benign Het
Dclk3 T C 9: 111,488,575 Y760H probably damaging Het
Eef1akmt2 A G 7: 132,837,206 *52R probably null Het
Epc2 A G 2: 49,528,854 K225E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxi2 C T 7: 135,410,398 T5M possibly damaging Het
Frmd4b T A 6: 97,296,260 T670S probably damaging Het
Gm14137 G T 2: 119,175,480 E173D probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Mfsd4b3 G A 10: 39,947,188 probably benign Het
Mlst8 A G 17: 24,476,153 F252S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mogs A G 6: 83,117,315 K371R probably benign Het
Nsun2 T C 13: 69,543,608 probably benign Het
Otog T A 7: 46,305,508 C2702S probably damaging Het
Plekhg4 A G 8: 105,380,388 E905G probably damaging Het
Rtn4rl1 T C 11: 75,265,261 V173A probably benign Het
Sall3 T C 18: 80,973,450 E421G probably benign Het
Setd6 G A 8: 95,716,275 probably null Het
Sh3tc1 T C 5: 35,714,059 probably null Het
Snx1 A G 9: 66,089,108 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T C 6: 48,495,155 V792A probably benign Het
Sufu C A 19: 46,473,599 D350E probably benign Het
Trav18 C A 14: 53,831,569 Q23K probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Usp17le T A 7: 104,769,104 H277L probably benign Het
Wdsub1 A G 2: 59,876,829 S20P probably damaging Het
Other mutations in Slc35f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc35f5 APN 1 125587424 missense probably damaging 1.00
IGL01844:Slc35f5 APN 1 125589875 missense probably damaging 0.96
IGL02218:Slc35f5 APN 1 125584555 missense probably damaging 1.00
IGL02586:Slc35f5 APN 1 125584536 missense probably damaging 1.00
IGL03000:Slc35f5 APN 1 125574742 missense probably damaging 1.00
IGL03160:Slc35f5 APN 1 125574735 missense probably damaging 1.00
IGL03181:Slc35f5 APN 1 125585185 missense probably damaging 1.00
R0127:Slc35f5 UTSW 1 125576205 missense probably damaging 1.00
R0390:Slc35f5 UTSW 1 125585095 missense probably damaging 1.00
R0513:Slc35f5 UTSW 1 125576169 splice site probably benign
R1701:Slc35f5 UTSW 1 125570593 missense possibly damaging 0.77
R1716:Slc35f5 UTSW 1 125584532 missense possibly damaging 0.65
R2211:Slc35f5 UTSW 1 125579264 missense possibly damaging 0.74
R3024:Slc35f5 UTSW 1 125568598 missense probably benign 0.00
R3870:Slc35f5 UTSW 1 125562361 missense probably benign 0.00
R4239:Slc35f5 UTSW 1 125572474 missense possibly damaging 0.94
R4547:Slc35f5 UTSW 1 125572382 missense probably benign 0.00
R5622:Slc35f5 UTSW 1 125589956 missense probably damaging 1.00
R5688:Slc35f5 UTSW 1 125591038 missense probably benign 0.23
R5876:Slc35f5 UTSW 1 125587363 critical splice acceptor site probably null
R6701:Slc35f5 UTSW 1 125562610 missense probably damaging 1.00
R7292:Slc35f5 UTSW 1 125572485 missense probably damaging 0.99
R7368:Slc35f5 UTSW 1 125584519 missense probably damaging 1.00
R7530:Slc35f5 UTSW 1 125584538 missense probably damaging 1.00
R7807:Slc35f5 UTSW 1 125584541 missense probably damaging 1.00
R8004:Slc35f5 UTSW 1 125589887 missense probably damaging 0.98
Z1177:Slc35f5 UTSW 1 125560705 start gained probably benign
Z1177:Slc35f5 UTSW 1 125585234 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCTCCATTTGGACTGGGC -3'
(R):5'- GGTCCATGTTAATTCTATCACAGTGC -3'

Sequencing Primer
(F):5'- CATTTGAGGATCTCAGAGAAGCCC -3'
(R):5'- TCACAGTGCAACATCATTGGTGG -3'
Posted On2017-02-01