Incidental Mutation 'IGL02984:Crb1'
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #IGL02984 (G1)
Quality Score214
Status Not validated
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CG to C at 139237086 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000198445]
Predicted Effect probably null
Transcript: ENSMUST00000059825
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681

low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198445
SMART Domains Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681

low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 333 1.63e1 SMART
EGF_CA 335 377 2.54e-7 SMART
EGF 382 419 1.47e-3 SMART
LamG 444 589 1.75e-9 SMART
EGF 613 646 6.5e-5 SMART
LamG 673 798 1.05e-7 SMART
EGF 828 861 1.19e-3 SMART
LamG 910 1043 6.85e-12 SMART
EGF 1080 1113 7.07e-6 SMART
EGF_CA 1115 1150 3.01e-9 SMART
EGF 1155 1188 3.57e-2 SMART
EGF 1196 1233 6.92e0 SMART
EGF_CA 1235 1271 4.19e-8 SMART
low complexity region 1282 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (43/43)
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,803 I473N probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A530064D06Rik T C 17: 48,163,280 I178V probably benign Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Aldh1l2 G A 10: 83,527,335 P55S probably damaging Het
Bglap3 T C 3: 88,368,791 T85A possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Csrnp3 A G 2: 66,022,209 D315G probably benign Het
Dclk3 T C 9: 111,488,575 Y760H probably damaging Het
Eef1akmt2 A G 7: 132,837,206 *52R probably null Het
Epc2 A G 2: 49,528,854 K225E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxi2 C T 7: 135,410,398 T5M possibly damaging Het
Frmd4b T A 6: 97,296,260 T670S probably damaging Het
Gm14137 G T 2: 119,175,480 E173D probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Mfsd4b3 G A 10: 39,947,188 probably benign Het
Mlst8 A G 17: 24,476,153 F252S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mogs A G 6: 83,117,315 K371R probably benign Het
Nsun2 T C 13: 69,543,608 probably benign Het
Otog T A 7: 46,305,508 C2702S probably damaging Het
Plekhg4 A G 8: 105,380,388 E905G probably damaging Het
Rtn4rl1 T C 11: 75,265,261 V173A probably benign Het
Sall3 T C 18: 80,973,450 E421G probably benign Het
Setd6 G A 8: 95,716,275 probably null Het
Sh3tc1 T C 5: 35,714,059 probably null Het
Slc35f5 T A 1: 125,562,513 Y71N probably benign Het
Snx1 A G 9: 66,089,108 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T C 6: 48,495,155 V792A probably benign Het
Sufu C A 19: 46,473,599 D350E probably benign Het
Trav18 C A 14: 53,831,569 Q23K probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Usp17le T A 7: 104,769,104 H277L probably benign Het
Wdsub1 A G 2: 59,876,829 S20P probably damaging Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0325:Crb1 UTSW 1 139241166 missense probably damaging 1.00
R0401:Crb1 UTSW 1 139198791 splice site probably benign
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R0734:Crb1 UTSW 1 139337084 missense probably benign 0.25
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2057:Crb1 UTSW 1 139314750 missense probably damaging 1.00
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R5968:Crb1 UTSW 1 139243001 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
R7020:Crb1 UTSW 1 139231603 missense possibly damaging 0.85
R7072:Crb1 UTSW 1 139237275 missense probably damaging 1.00
R7073:Crb1 UTSW 1 139248311 missense probably damaging 0.99
R7135:Crb1 UTSW 1 139243367 missense probably damaging 0.97
R7493:Crb1 UTSW 1 139237030 missense probably damaging 1.00
R7539:Crb1 UTSW 1 139248229 missense probably damaging 1.00
R7554:Crb1 UTSW 1 139337281 missense probably damaging 1.00
R7593:Crb1 UTSW 1 139237240 missense probably damaging 1.00
R7740:Crb1 UTSW 1 139237690 missense probably benign 0.01
R7912:Crb1 UTSW 1 139243171 missense probably damaging 1.00
R8036:Crb1 UTSW 1 139237384 missense probably benign 0.07
R8042:Crb1 UTSW 1 139314654 missense probably damaging 0.99
R8329:Crb1 UTSW 1 139237267 missense probably damaging 1.00
R8332:Crb1 UTSW 1 139237414 missense probably damaging 0.96
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Z1176:Crb1 UTSW 1 139237086 frame shift probably null
Z1177:Crb1 UTSW 1 139237086 frame shift probably null
Z1177:Crb1 UTSW 1 139248901 missense possibly damaging 0.80
Z1177:Crb1 UTSW 1 139337028 critical splice donor site probably null
Predicted Primers
Posted On2017-02-01