Incidental Mutation 'IGL02984:Gm14137'
ID453259
Institutional Source Beutler Lab
Gene Symbol Gm14137
Ensembl Gene ENSMUSG00000055926
Gene Namepredicted gene 14137
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02984 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location119174509-119177575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119175480 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 173 (E173D)
Ref Sequence ENSEMBL: ENSMUSP00000068999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038439] [ENSMUST00000057454] [ENSMUST00000069711]
Predicted Effect probably benign
Transcript: ENSMUST00000038439
SMART Domains Protein: ENSMUSP00000041841
Gene: ENSMUSG00000034278

DomainStartEndE-ValueType
DnaJ 10 68 3.66e-21 SMART
coiled coil region 112 151 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
Pfam:RRM_1 187 243 1.8e-6 PFAM
Pfam:RRM_5 194 246 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057454
SMART Domains Protein: ENSMUSP00000060835
Gene: ENSMUSG00000046814

DomainStartEndE-ValueType
Pfam:GFRP 2 84 2.8e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069711
AA Change: E173D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141009
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (43/43)
MGI Phenotype Mice homozygous for a gene trapped allele die before implantation.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,803 I473N probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A530064D06Rik T C 17: 48,163,280 I178V probably benign Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Aldh1l2 G A 10: 83,527,335 P55S probably damaging Het
Bglap3 T C 3: 88,368,791 T85A possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csrnp3 A G 2: 66,022,209 D315G probably benign Het
Dclk3 T C 9: 111,488,575 Y760H probably damaging Het
Eef1akmt2 A G 7: 132,837,206 *52R probably null Het
Epc2 A G 2: 49,528,854 K225E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxi2 C T 7: 135,410,398 T5M possibly damaging Het
Frmd4b T A 6: 97,296,260 T670S probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Mfsd4b3 G A 10: 39,947,188 probably benign Het
Mlst8 A G 17: 24,476,153 F252S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mogs A G 6: 83,117,315 K371R probably benign Het
Nsun2 T C 13: 69,543,608 probably benign Het
Otog T A 7: 46,305,508 C2702S probably damaging Het
Plekhg4 A G 8: 105,380,388 E905G probably damaging Het
Rtn4rl1 T C 11: 75,265,261 V173A probably benign Het
Sall3 T C 18: 80,973,450 E421G probably benign Het
Setd6 G A 8: 95,716,275 probably null Het
Sh3tc1 T C 5: 35,714,059 probably null Het
Slc35f5 T A 1: 125,562,513 Y71N probably benign Het
Snx1 A G 9: 66,089,108 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T C 6: 48,495,155 V792A probably benign Het
Sufu C A 19: 46,473,599 D350E probably benign Het
Trav18 C A 14: 53,831,569 Q23K probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Usp17le T A 7: 104,769,104 H277L probably benign Het
Wdsub1 A G 2: 59,876,829 S20P probably damaging Het
Other mutations in Gm14137
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Gm14137 APN 2 119175326 missense probably damaging 0.96
R0729:Gm14137 UTSW 2 119175353 missense probably benign 0.00
R1203:Gm14137 UTSW 2 119175124 missense probably damaging 1.00
R3964:Gm14137 UTSW 2 119175016 missense probably benign 0.27
R3966:Gm14137 UTSW 2 119175016 missense probably benign 0.27
R6298:Gm14137 UTSW 2 119175091 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TTCAGCAATCTCCCTGACAGG -3'
(R):5'- CTCCTGCCAGAAAGTGACTC -3'

Sequencing Primer
(F):5'- TGACAGGGCCGCTTCAC -3'
(R):5'- CCTTCACTTTGGGCGACTTGAAG -3'
Posted On2017-02-01