Incidental Mutation 'IGL02984:Bglap3'
ID453260
Institutional Source Beutler Lab
Gene Symbol Bglap3
Ensembl Gene ENSMUSG00000074489
Gene Namebone gamma-carboxyglutamate protein 3
SynonymsORG, Bglap-rs1, mOC-X
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #IGL02984 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88368616-88372743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88368791 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 85 (T85A)
Ref Sequence ENSEMBL: ENSMUSP00000103167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075523] [ENSMUST00000107542] [ENSMUST00000107543] [ENSMUST00000147948] [ENSMUST00000147991]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075523
AA Change: T85A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074965
Gene: ENSMUSG00000074489
AA Change: T85A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107542
AA Change: T85A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103166
Gene: ENSMUSG00000074489
AA Change: T85A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107543
AA Change: T85A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103167
Gene: ENSMUSG00000074489
AA Change: T85A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147818
Predicted Effect probably benign
Transcript: ENSMUST00000147948
SMART Domains Protein: ENSMUSP00000119656
Gene: ENSMUSG00000041423

DomainStartEndE-ValueType
Pfam:HlyIII 59 161 6.8e-18 PFAM
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147991
SMART Domains Protein: ENSMUSP00000114166
Gene: ENSMUSG00000041423

DomainStartEndE-ValueType
Pfam:HlyIII 43 271 5.5e-51 PFAM
transmembrane domain 292 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152477
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,803 I473N probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A530064D06Rik T C 17: 48,163,280 I178V probably benign Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Aldh1l2 G A 10: 83,527,335 P55S probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csrnp3 A G 2: 66,022,209 D315G probably benign Het
Dclk3 T C 9: 111,488,575 Y760H probably damaging Het
Eef1akmt2 A G 7: 132,837,206 *52R probably null Het
Epc2 A G 2: 49,528,854 K225E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxi2 C T 7: 135,410,398 T5M possibly damaging Het
Frmd4b T A 6: 97,296,260 T670S probably damaging Het
Gm14137 G T 2: 119,175,480 E173D probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Mfsd4b3 G A 10: 39,947,188 probably benign Het
Mlst8 A G 17: 24,476,153 F252S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mogs A G 6: 83,117,315 K371R probably benign Het
Nsun2 T C 13: 69,543,608 probably benign Het
Otog T A 7: 46,305,508 C2702S probably damaging Het
Plekhg4 A G 8: 105,380,388 E905G probably damaging Het
Rtn4rl1 T C 11: 75,265,261 V173A probably benign Het
Sall3 T C 18: 80,973,450 E421G probably benign Het
Setd6 G A 8: 95,716,275 probably null Het
Sh3tc1 T C 5: 35,714,059 probably null Het
Slc35f5 T A 1: 125,562,513 Y71N probably benign Het
Snx1 A G 9: 66,089,108 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T C 6: 48,495,155 V792A probably benign Het
Sufu C A 19: 46,473,599 D350E probably benign Het
Trav18 C A 14: 53,831,569 Q23K probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Usp17le T A 7: 104,769,104 H277L probably benign Het
Wdsub1 A G 2: 59,876,829 S20P probably damaging Het
Other mutations in Bglap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Bglap3 APN 3 88369116 missense possibly damaging 0.90
R0496:Bglap3 UTSW 3 88369137 missense probably damaging 0.98
R1435:Bglap3 UTSW 3 88369146 missense possibly damaging 0.70
R1903:Bglap3 UTSW 3 88368761 missense probably benign 0.01
R1970:Bglap3 UTSW 3 88376993 unclassified probably benign
R2296:Bglap3 UTSW 3 88369512 unclassified probably benign
R2326:Bglap3 UTSW 3 88369512 unclassified probably benign
R2917:Bglap3 UTSW 3 88369512 unclassified probably benign
R4967:Bglap3 UTSW 3 88376364 unclassified probably benign
R5941:Bglap3 UTSW 3 88376346 unclassified probably benign
R6259:Bglap3 UTSW 3 88368760 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATTGAGTGTGAAGCCTTCCC -3'
(R):5'- GAAGAGGATGTGTGTACCCTG -3'

Sequencing Primer
(F):5'- TGGACAGACTCCAGCCCAG -3'
(R):5'- GTGTACCCTGTGTATATTAATGCCAC -3'
Posted On2017-02-01