Incidental Mutation 'R0554:Prss48'
ID 45327
Institutional Source Beutler Lab
Gene Symbol Prss48
Ensembl Gene ENSMUSG00000049013
Gene Name serine protease 48
Synonyms Gm1019, Esspl
MMRRC Submission 038746-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R0554 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 85901117-85909798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85908228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 18 (Q18L)
Ref Sequence ENSEMBL: ENSMUSP00000051199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061343]
AlphaFold Q14B25
Predicted Effect probably benign
Transcript: ENSMUST00000061343
AA Change: Q18L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000051199
Gene: ENSMUSG00000049013
AA Change: Q18L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 39 271 9.46e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182969
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,982,181 (GRCm39) Y255* probably null Het
1810024B03Rik A G 2: 127,029,196 (GRCm39) M1T probably null Het
4930503L19Rik T C 18: 70,600,451 (GRCm39) D386G probably damaging Het
Ace2 T A X: 162,958,947 (GRCm39) N601K probably benign Het
Adam4 A C 12: 81,468,198 (GRCm39) I141R probably damaging Het
Adcy10 G A 1: 165,340,699 (GRCm39) G235S probably benign Het
Adcy5 G A 16: 35,114,387 (GRCm39) V997I probably benign Het
Aff2 T G X: 68,907,680 (GRCm39) W1221G possibly damaging Het
Ankrd44 T C 1: 54,802,917 (GRCm39) N194D probably benign Het
Apba2 T G 7: 64,395,528 (GRCm39) L668R probably damaging Het
Asph T C 4: 9,604,581 (GRCm39) D152G probably damaging Het
Bcl3 C G 7: 19,553,991 (GRCm39) V126L probably benign Het
Cd163 A G 6: 124,289,619 (GRCm39) T446A probably benign Het
Cd209g C T 8: 4,184,995 (GRCm39) probably benign Het
Cdadc1 A T 14: 59,823,901 (GRCm39) V197E probably damaging Het
CN725425 T C 15: 91,144,966 (GRCm39) C610R possibly damaging Het
Col6a2 A G 10: 76,446,995 (GRCm39) probably null Het
Coro7 A G 16: 4,450,121 (GRCm39) L576P possibly damaging Het
Dgkb T A 12: 38,266,030 (GRCm39) V503E probably benign Het
Dhx57 A T 17: 80,567,665 (GRCm39) L806* probably null Het
Dlec1 T C 9: 118,944,070 (GRCm39) V373A probably benign Het
Dnah11 G T 12: 117,894,913 (GRCm39) R3645S probably benign Het
Dnhd1 T C 7: 105,343,602 (GRCm39) S1649P probably benign Het
Draxin T G 4: 148,192,420 (GRCm39) K297N probably damaging Het
Epha7 T C 4: 28,951,401 (GRCm39) S841P probably damaging Het
Esp8 T G 17: 40,841,166 (GRCm39) D142E unknown Het
F5 T G 1: 164,007,018 (GRCm39) V274G probably damaging Het
Fancc T C 13: 63,465,283 (GRCm39) S475G probably benign Het
Fmo3 T C 1: 162,781,901 (GRCm39) N484S probably benign Het
Focad T C 4: 88,267,126 (GRCm39) Y1046H unknown Het
Furin C T 7: 80,041,032 (GRCm39) G602D probably damaging Het
Fut8 A T 12: 77,411,744 (GRCm39) I69L probably benign Het
Gnai3 A G 3: 108,030,928 (GRCm39) I78T probably benign Het
Gpr182 T C 10: 127,586,940 (GRCm39) I4V probably benign Het
Gpr63 T C 4: 25,007,447 (GRCm39) M57T probably benign Het
Grm1 T A 10: 10,595,667 (GRCm39) T654S probably benign Het
Gtf2h4 T C 17: 35,979,531 (GRCm39) T371A probably benign Het
Helq T C 5: 100,938,066 (GRCm39) N460S probably benign Het
Hmcn1 T C 1: 150,594,868 (GRCm39) N1867S probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Iigp1c G A 18: 60,378,489 (GRCm39) R8H probably benign Het
Inpp5j A G 11: 3,449,644 (GRCm39) Y713H probably damaging Het
Ints6 A T 14: 62,942,200 (GRCm39) V511D possibly damaging Het
Irag2 G A 6: 145,111,013 (GRCm39) A237T probably benign Het
Itga4 A G 2: 79,109,461 (GRCm39) Y220C probably damaging Het
Itgav T G 2: 83,624,614 (GRCm39) S735A possibly damaging Het
Kctd16 A G 18: 40,391,492 (GRCm39) I27V probably benign Het
Klhl6 T C 16: 19,772,343 (GRCm39) E334G probably damaging Het
Ltbp1 T A 17: 75,532,274 (GRCm39) L116H probably damaging Het
Magohb T A 6: 131,262,660 (GRCm39) H98L probably benign Het
Mgat2 A G 12: 69,232,166 (GRCm39) T247A probably benign Het
Mtif2 G A 11: 29,483,398 (GRCm39) probably null Het
Myrfl T C 10: 116,664,878 (GRCm39) E384G probably damaging Het
Nfam1 G T 15: 82,917,410 (GRCm39) R8S probably benign Het
Numa1 T C 7: 101,644,731 (GRCm39) S236P possibly damaging Het
Or14c46 A T 7: 85,918,865 (GRCm39) I44N probably damaging Het
Or2w3b T C 11: 58,623,865 (GRCm39) N42S probably damaging Het
Or5m10b T C 2: 85,699,863 (GRCm39) F309S probably benign Het
Or6c207 T C 10: 129,104,368 (GRCm39) T275A probably benign Het
Orc4 C T 2: 48,795,433 (GRCm39) S431N probably benign Het
Pax2 T C 19: 44,750,300 (GRCm39) V129A probably damaging Het
Pcdhb15 A G 18: 37,607,572 (GRCm39) D268G probably damaging Het
Pdcd1 G A 1: 93,967,107 (GRCm39) R264C probably damaging Het
Pi15 T A 1: 17,691,872 (GRCm39) M187K probably benign Het
Plag1 C T 4: 3,904,546 (GRCm39) C215Y probably damaging Het
Plagl1 A G 10: 13,002,926 (GRCm39) T65A probably benign Het
Pramel51 T C 12: 88,144,328 (GRCm39) T162A probably benign Het
Prune2 T A 19: 17,102,582 (GRCm39) C2580* probably null Het
Rab40b T A 11: 121,250,432 (GRCm39) Q74L probably damaging Het
Raf1 A G 6: 115,600,491 (GRCm39) I376T probably benign Het
Rbm46 A T 3: 82,772,575 (GRCm39) F186I probably damaging Het
Reps1 C T 10: 17,998,867 (GRCm39) T720M possibly damaging Het
Rgs22 A G 15: 36,054,855 (GRCm39) M649T probably benign Het
Rhot1 C T 11: 80,134,264 (GRCm39) R47* probably null Het
Rhox2f A G X: 36,753,124 (GRCm39) Y8C possibly damaging Het
Rnf17 A G 14: 56,760,007 (GRCm39) Y1604C probably damaging Het
Rnf40 T C 7: 127,201,756 (GRCm39) C943R probably damaging Het
Ropn1l A T 15: 31,451,295 (GRCm39) M63K probably benign Het
Sbf2 C A 7: 110,027,494 (GRCm39) V501F probably damaging Het
Sh3bp1 T A 15: 78,791,467 (GRCm39) M354K probably damaging Het
Sipa1l3 T C 7: 29,087,455 (GRCm39) H590R possibly damaging Het
Slco6d1 T A 1: 98,394,422 (GRCm39) C369S probably benign Het
Sulf1 T C 1: 12,875,418 (GRCm39) Y143H probably damaging Het
Tiam2 A T 17: 3,488,956 (GRCm39) R755* probably null Het
Trim12c C A 7: 103,994,169 (GRCm39) L228F probably damaging Het
Ttc23l G T 15: 10,530,743 (GRCm39) Q290K probably benign Het
Uba3 T C 6: 97,168,221 (GRCm39) probably null Het
Ugt1a10 A G 1: 87,983,817 (GRCm39) E205G probably damaging Het
Ugt3a1 T A 15: 9,351,206 (GRCm39) S72T probably benign Het
Upk3bl C T 5: 136,088,648 (GRCm39) T113I probably damaging Het
Uspl1 T A 5: 149,124,644 (GRCm39) D20E probably damaging Het
Vmn2r19 G A 6: 123,313,102 (GRCm39) G724E probably damaging Het
Vmn2r63 T A 7: 42,583,129 (GRCm39) K29* probably null Het
Vwf C T 6: 125,619,744 (GRCm39) A1474V probably benign Het
Xpc C T 6: 91,468,208 (GRCm39) A860T probably benign Het
Zfp462 A G 4: 55,013,689 (GRCm39) H737R probably damaging Het
Zfp536 T C 7: 37,180,244 (GRCm39) D787G probably damaging Het
Zfp692 A G 11: 58,205,053 (GRCm39) H434R probably damaging Het
Zp1 C A 19: 10,897,926 (GRCm39) C5F probably benign Het
Other mutations in Prss48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03334:Prss48 APN 3 85,904,625 (GRCm39) missense probably damaging 1.00
R1903:Prss48 UTSW 3 85,905,614 (GRCm39) nonsense probably null
R2884:Prss48 UTSW 3 85,904,562 (GRCm39) missense probably benign 0.10
R5730:Prss48 UTSW 3 85,904,563 (GRCm39) missense possibly damaging 0.89
R5889:Prss48 UTSW 3 85,905,492 (GRCm39) missense probably damaging 1.00
R6625:Prss48 UTSW 3 85,905,373 (GRCm39) missense probably benign 0.02
R7357:Prss48 UTSW 3 85,904,528 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTCAAAACGCAGGCTCACC -3'
(R):5'- ACGTCAGTTGCCATAGGCAGGAAG -3'

Sequencing Primer
(F):5'- gcataccagaagagggcatc -3'
(R):5'- TACCACCACTCTGGAAAGCT -3'
Posted On 2013-06-11