Incidental Mutation 'IGL02984:Sall3'
ID453288
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02984 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80973450 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 421 (E421G)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: E421G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: E421G

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Meta Mutation Damage Score 0.2845 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,803 I473N probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A530064D06Rik T C 17: 48,163,280 I178V probably benign Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Aldh1l2 G A 10: 83,527,335 P55S probably damaging Het
Bglap3 T C 3: 88,368,791 T85A possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csrnp3 A G 2: 66,022,209 D315G probably benign Het
Dclk3 T C 9: 111,488,575 Y760H probably damaging Het
Eef1akmt2 A G 7: 132,837,206 *52R probably null Het
Epc2 A G 2: 49,528,854 K225E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxi2 C T 7: 135,410,398 T5M possibly damaging Het
Frmd4b T A 6: 97,296,260 T670S probably damaging Het
Gm14137 G T 2: 119,175,480 E173D probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Mfsd4b3 G A 10: 39,947,188 probably benign Het
Mlst8 A G 17: 24,476,153 F252S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mogs A G 6: 83,117,315 K371R probably benign Het
Nsun2 T C 13: 69,543,608 probably benign Het
Otog T A 7: 46,305,508 C2702S probably damaging Het
Plekhg4 A G 8: 105,380,388 E905G probably damaging Het
Rtn4rl1 T C 11: 75,265,261 V173A probably benign Het
Setd6 G A 8: 95,716,275 probably null Het
Sh3tc1 T C 5: 35,714,059 probably null Het
Slc35f5 T A 1: 125,562,513 Y71N probably benign Het
Snx1 A G 9: 66,089,108 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T C 6: 48,495,155 V792A probably benign Het
Sufu C A 19: 46,473,599 D350E probably benign Het
Trav18 C A 14: 53,831,569 Q23K probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Usp17le T A 7: 104,769,104 H277L probably benign Het
Wdsub1 A G 2: 59,876,829 S20P probably damaging Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense probably benign 0.03
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATTGTCGAGGTATTCTGGGAC -3'
(R):5'- TCAGCTCAGCCTCCAATCTG -3'

Sequencing Primer
(F):5'- GTACTTCTCCTTGTGCCTCTGAAAG -3'
(R):5'- ATCTGCCAAACCCTCTGCTAC -3'
Posted On2017-02-01