Incidental Mutation 'IGL03014:Ccdc150'
ID 453292
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Name coiled-coil domain containing 150
Synonyms 4930511H11Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # IGL03014 (G1)
Quality Score 198
Status Validated
Chromosome 1
Chromosomal Location 54289842-54407886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 54329861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 395 (V395F)
Ref Sequence ENSEMBL: ENSMUSP00000125195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
AlphaFold Q8CDI7
Predicted Effect possibly damaging
Transcript: ENSMUST00000027128
AA Change: V395F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: V395F

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160472
AA Change: V395F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983
AA Change: V395F

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
AW112010 A G 19: 11,025,456 (GRCm39) noncoding transcript Het
Ccdc134 T C 15: 82,014,306 (GRCm39) L13P probably damaging Het
Cdh22 G T 2: 164,954,331 (GRCm39) S730* probably null Het
Cfap20dc A G 14: 8,431,608 (GRCm38) *675Q probably null Het
Chrng G T 1: 87,138,759 (GRCm39) probably null Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Csmd2 G T 4: 128,190,222 (GRCm39) M387I probably benign Het
Cux1 T C 5: 136,594,379 (GRCm39) probably benign Het
D130043K22Rik C T 13: 25,042,075 (GRCm39) P335S possibly damaging Het
Dctn1 A G 6: 83,174,351 (GRCm39) probably benign Het
Dock11 G T X: 35,310,699 (GRCm39) probably benign Het
Dsn1 A T 2: 156,838,739 (GRCm39) M292K possibly damaging Het
Efemp1 A G 11: 28,876,218 (GRCm39) Y461C probably damaging Het
Efl1 A G 7: 82,301,094 (GRCm39) T33A probably damaging Het
Fbln2 T C 6: 91,242,901 (GRCm39) probably benign Het
Fcna G C 2: 25,520,693 (GRCm39) probably benign Het
Hecw1 T A 13: 14,420,393 (GRCm39) Y1010F probably damaging Het
Igha A G 12: 113,222,713 (GRCm39) V236A unknown Het
Igsf9b T C 9: 27,233,932 (GRCm39) M377T probably benign Het
Itga9 A G 9: 118,457,212 (GRCm39) T108A probably benign Het
Kcna3 A T 3: 106,945,206 (GRCm39) M490L probably benign Het
Lama3 A T 18: 12,673,024 (GRCm39) Y886F possibly damaging Het
Lcorl T C 5: 45,931,371 (GRCm39) probably benign Het
Lyl1 C T 8: 85,429,300 (GRCm39) P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Odr4 C A 1: 150,258,804 (GRCm39) probably benign Het
Or1a1b G A 11: 74,097,653 (GRCm39) L130F probably damaging Het
Or51a39 A T 7: 102,362,753 (GRCm39) V289E probably null Het
Pex10 A G 4: 155,155,076 (GRCm39) probably benign Het
Plcl2 G A 17: 50,918,029 (GRCm39) V943M possibly damaging Het
Prkcd T A 14: 30,329,294 (GRCm39) T164S probably damaging Het
Ptprn2 T A 12: 117,212,308 (GRCm39) L910Q probably damaging Het
Rab1b T C 19: 5,154,923 (GRCm39) I41V probably benign Het
Scpep1 T A 11: 88,824,271 (GRCm39) probably null Het
Sergef T C 7: 46,240,180 (GRCm39) T288A probably damaging Het
Setdb1 G A 3: 95,248,726 (GRCm39) P397S probably damaging Het
Setx T A 2: 29,029,423 (GRCm39) D230E probably damaging Het
Sin3a C A 9: 57,002,539 (GRCm39) probably benign Het
Smad5 T C 13: 56,883,754 (GRCm39) L380P probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Stard9 A T 2: 120,532,675 (GRCm39) probably benign Het
Tek A G 4: 94,715,500 (GRCm39) D346G probably benign Het
Trav7d-4 T A 14: 53,007,353 (GRCm39) W12R unknown Het
Trmt1l G T 1: 151,333,681 (GRCm39) W728L probably damaging Het
Ubash3a C A 17: 31,458,198 (GRCm39) T559K probably damaging Het
Vmn1r72 T A 7: 11,403,711 (GRCm39) I246F possibly damaging Het
Zfp618 A T 4: 62,998,325 (GRCm39) Q109L probably damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54,311,709 (GRCm39) splice site probably benign
IGL00819:Ccdc150 APN 1 54,302,732 (GRCm39) missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54,339,647 (GRCm39) splice site probably null
IGL02352:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54,302,704 (GRCm39) nonsense probably null
IGL02673:Ccdc150 APN 1 54,368,149 (GRCm39) missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54,317,874 (GRCm39) missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54,339,482 (GRCm39) missense probably damaging 1.00
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0217:Ccdc150 UTSW 1 54,339,589 (GRCm39) missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54,368,670 (GRCm39) missense probably benign
R0687:Ccdc150 UTSW 1 54,324,790 (GRCm39) splice site probably null
R0790:Ccdc150 UTSW 1 54,316,935 (GRCm39) splice site probably benign
R1146:Ccdc150 UTSW 1 54,404,130 (GRCm39) splice site probably benign
R1288:Ccdc150 UTSW 1 54,403,617 (GRCm39) missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54,393,795 (GRCm39) missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54,407,069 (GRCm39) intron probably benign
R1957:Ccdc150 UTSW 1 54,303,068 (GRCm39) missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54,311,706 (GRCm39) critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54,404,084 (GRCm39) missense probably null 0.11
R3054:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54,407,469 (GRCm39) missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54,317,970 (GRCm39) missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54,392,213 (GRCm39) missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54,394,913 (GRCm39) missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54,317,874 (GRCm39) missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54,404,027 (GRCm39) intron probably benign
R5028:Ccdc150 UTSW 1 54,302,636 (GRCm39) missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54,393,806 (GRCm39) missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54,302,779 (GRCm39) missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54,339,526 (GRCm39) missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54,316,873 (GRCm39) missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54,302,758 (GRCm39) missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54,407,176 (GRCm39) missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54,303,116 (GRCm39) splice site probably null
R6988:Ccdc150 UTSW 1 54,394,868 (GRCm39) nonsense probably null
R7248:Ccdc150 UTSW 1 54,344,057 (GRCm39) missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54,302,496 (GRCm39) splice site probably null
R7322:Ccdc150 UTSW 1 54,299,125 (GRCm39) missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54,339,541 (GRCm39) nonsense probably null
R7647:Ccdc150 UTSW 1 54,395,863 (GRCm39) missense probably damaging 1.00
R7981:Ccdc150 UTSW 1 54,407,551 (GRCm39) missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54,311,656 (GRCm39) missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54,368,646 (GRCm39) missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54,407,132 (GRCm39) missense probably damaging 1.00
R8719:Ccdc150 UTSW 1 54,302,668 (GRCm39) missense probably benign 0.00
R8963:Ccdc150 UTSW 1 54,311,641 (GRCm39) missense probably benign 0.14
R9178:Ccdc150 UTSW 1 54,311,644 (GRCm39) missense probably damaging 0.99
R9200:Ccdc150 UTSW 1 54,299,197 (GRCm39) missense probably damaging 1.00
R9332:Ccdc150 UTSW 1 54,316,910 (GRCm39) missense probably damaging 0.99
R9367:Ccdc150 UTSW 1 54,324,760 (GRCm39) missense probably damaging 1.00
R9416:Ccdc150 UTSW 1 54,317,990 (GRCm39) missense probably damaging 0.97
R9430:Ccdc150 UTSW 1 54,320,930 (GRCm39) missense probably damaging 1.00
R9576:Ccdc150 UTSW 1 54,407,544 (GRCm39) nonsense probably null
R9747:Ccdc150 UTSW 1 54,299,107 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTTCACAAAATATGTTCAAGGCTGG -3'
(R):5'- TGAACAAAGGTGCACACGTG -3'

Sequencing Primer
(F):5'- TCAAGGCTGGTATATAATACTTCCTC -3'
(R):5'- TCATTCTGCACAGCTTGG -3'
Posted On 2017-02-01