Incidental Mutation 'IGL03014:Vmn1r72'
ID453314
Institutional Source Beutler Lab
Gene Symbol Vmn1r72
Ensembl Gene ENSMUSG00000095430
Gene Namevomeronasal 1 receptor 72
SynonymsV1rg1
Accession Numbers

Genbank: NM_145843; MGI: 2182256

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #IGL03014 (G1)
Quality Score128
Status Validated
Chromosome7
Chromosomal Location11664479-11680147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11669784 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 246 (I246F)
Ref Sequence ENSEMBL: ENSMUSP00000154511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053134] [ENSMUST00000209638] [ENSMUST00000227010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053134
AA Change: I246F

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052997
Gene: ENSMUSG00000095430
AA Change: I246F

DomainStartEndE-ValueType
Pfam:TAS2R 1 305 1.8e-9 PFAM
Pfam:V1R 25 300 6.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209638
AA Change: I246F

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227010
AA Change: I246F

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,608 *675Q probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
AW112010 A G 19: 11,048,092 noncoding transcript Het
BC003331 C A 1: 150,383,053 probably benign Het
Ccdc134 T C 15: 82,130,105 L13P probably damaging Het
Ccdc150 G T 1: 54,290,702 V395F probably damaging Het
Cdh22 G T 2: 165,112,411 S730* probably null Het
Chrng G T 1: 87,211,037 probably null Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd2 G T 4: 128,296,429 M387I probably benign Het
Cux1 T C 5: 136,565,525 probably benign Het
D130043K22Rik C T 13: 24,858,092 P335S possibly damaging Het
Dctn1 A G 6: 83,197,369 probably benign Het
Dock11 G T X: 36,047,046 probably benign Het
Dsn1 A T 2: 156,996,819 M292K possibly damaging Het
Efemp1 A G 11: 28,926,218 Y461C probably damaging Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Fbln2 T C 6: 91,265,919 probably benign Het
Fcna G C 2: 25,630,681 probably benign Het
Hecw1 T A 13: 14,245,808 Y1010F probably damaging Het
Igha A G 12: 113,259,093 V236A unknown Het
Igsf9b T C 9: 27,322,636 M377T probably benign Het
Itga9 A G 9: 118,628,144 T108A probably benign Het
Kcna3 A T 3: 107,037,890 M490L probably benign Het
Lama3 A T 18: 12,539,967 Y886F possibly damaging Het
Lcorl T C 5: 45,774,029 probably benign Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Olfr33 A T 7: 102,713,546 V289E probably null Het
Olfr43 G A 11: 74,206,827 L130F probably damaging Het
Pex10 A G 4: 155,070,619 probably benign Het
Plcl2 G A 17: 50,611,001 V943M possibly damaging Het
Prkcd T A 14: 30,607,337 T164S probably damaging Het
Ptprn2 T A 12: 117,248,688 L910Q probably damaging Het
Rab1b T C 19: 5,104,895 I41V probably benign Het
Scpep1 T A 11: 88,933,445 probably null Het
Sergef T C 7: 46,590,756 T288A probably damaging Het
Setdb1 G A 3: 95,341,415 P397S probably damaging Het
Setx T A 2: 29,139,411 D230E probably damaging Het
Sin3a C A 9: 57,095,255 probably benign Het
Smad5 T C 13: 56,735,941 L380P probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stard9 A T 2: 120,702,194 probably benign Het
Tek A G 4: 94,827,263 D346G probably benign Het
Trav7d-4 T A 14: 52,769,896 W12R unknown Het
Trmt1l G T 1: 151,457,930 W728L probably damaging Het
Ubash3a C A 17: 31,239,224 T559K probably damaging Het
Zfp618 A T 4: 63,080,088 Q109L probably damaging Het
Other mutations in Vmn1r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Vmn1r72 APN 7 11670497 missense probably benign 0.41
IGL02375:Vmn1r72 APN 7 11669745 missense probably benign 0.10
IGL02809:Vmn1r72 APN 7 11670003 missense probably benign 0.03
IGL03104:Vmn1r72 APN 7 11669885 missense probably damaging 1.00
3-1:Vmn1r72 UTSW 7 11669898 missense probably damaging 0.97
R0346:Vmn1r72 UTSW 7 11669694 missense probably benign
R0524:Vmn1r72 UTSW 7 11669792 missense probably benign 0.32
R1951:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R1953:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R2181:Vmn1r72 UTSW 7 11669668 nonsense probably null
R4182:Vmn1r72 UTSW 7 11670068 missense probably benign 0.00
R4345:Vmn1r72 UTSW 7 11670036 missense possibly damaging 0.86
R4496:Vmn1r72 UTSW 7 11669864 missense probably damaging 1.00
R4999:Vmn1r72 UTSW 7 11670373 missense possibly damaging 0.63
R5401:Vmn1r72 UTSW 7 11669916 missense probably damaging 1.00
R5700:Vmn1r72 UTSW 7 11670423 missense probably damaging 0.98
R5754:Vmn1r72 UTSW 7 11669849 missense probably damaging 0.99
R6292:Vmn1r72 UTSW 7 11669652 missense probably benign 0.02
R6439:Vmn1r72 UTSW 7 11679137 splice site probably null
R7616:Vmn1r72 UTSW 7 11670345 missense probably damaging 0.96
R7629:Vmn1r72 UTSW 7 11669784 missense probably benign
R7737:Vmn1r72 UTSW 7 11669707 missense probably damaging 0.98
R7819:Vmn1r72 UTSW 7 11669625 missense probably benign 0.01
R8358:Vmn1r72 UTSW 7 11670383 missense probably damaging 0.99
R8797:Vmn1r72 UTSW 7 11670038 missense probably benign
R8848:Vmn1r72 UTSW 7 11670342 missense probably damaging 0.98
R8947:Vmn1r72 UTSW 7 11669880 missense possibly damaging 0.89
X0063:Vmn1r72 UTSW 7 11669712 missense probably benign 0.00
Z1088:Vmn1r72 UTSW 7 11670173 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACATCCGCTCTGTGTGTATG -3'
(R):5'- ATGCTTCTCTGATGGACTGTGC -3'

Sequencing Primer
(F):5'- TGACAAACTTGGAGGAAGCTATCTC -3'
(R):5'- CTTGGGTCTCATGGCCTGC -3'
Posted On2017-02-01