Incidental Mutation 'IGL03014:Olfr33'
ID453317
Institutional Source Beutler Lab
Gene Symbol Olfr33
Ensembl Gene ENSMUSG00000066273
Gene Nameolfactory receptor 33
SynonymsMTPCR33, GA_x6K02T2PBJ9-5431102-5430146, MOR11-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #IGL03014 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102712151-102719070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102713546 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 289 (V289E)
Ref Sequence ENSEMBL: ENSMUSP00000081877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084817] [ENSMUST00000094124] [ENSMUST00000216312]
Predicted Effect probably null
Transcript: ENSMUST00000084817
AA Change: V289E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081877
Gene: ENSMUSG00000066273
AA Change: V289E

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 2.1e-117 PFAM
Pfam:7TM_GPCR_Srsx 41 211 7.5e-11 PFAM
Pfam:7tm_1 47 299 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094124
SMART Domains Protein: ENSMUSP00000091674
Gene: ENSMUSG00000070423

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 6.2e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 2.4e-7 PFAM
Pfam:7tm_1 43 293 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210002
Predicted Effect possibly damaging
Transcript: ENSMUST00000216312
AA Change: V289E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,608 *675Q probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
AW112010 A G 19: 11,048,092 noncoding transcript Het
BC003331 C A 1: 150,383,053 probably benign Het
Ccdc134 T C 15: 82,130,105 L13P probably damaging Het
Ccdc150 G T 1: 54,290,702 V395F probably damaging Het
Cdh22 G T 2: 165,112,411 S730* probably null Het
Chrng G T 1: 87,211,037 probably null Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd2 G T 4: 128,296,429 M387I probably benign Het
Cux1 T C 5: 136,565,525 probably benign Het
D130043K22Rik C T 13: 24,858,092 P335S possibly damaging Het
Dctn1 A G 6: 83,197,369 probably benign Het
Dock11 G T X: 36,047,046 probably benign Het
Dsn1 A T 2: 156,996,819 M292K possibly damaging Het
Efemp1 A G 11: 28,926,218 Y461C probably damaging Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Fbln2 T C 6: 91,265,919 probably benign Het
Fcna G C 2: 25,630,681 probably benign Het
Hecw1 T A 13: 14,245,808 Y1010F probably damaging Het
Igha A G 12: 113,259,093 V236A unknown Het
Igsf9b T C 9: 27,322,636 M377T probably benign Het
Itga9 A G 9: 118,628,144 T108A probably benign Het
Kcna3 A T 3: 107,037,890 M490L probably benign Het
Lama3 A T 18: 12,539,967 Y886F possibly damaging Het
Lcorl T C 5: 45,774,029 probably benign Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Olfr43 G A 11: 74,206,827 L130F probably damaging Het
Pex10 A G 4: 155,070,619 probably benign Het
Plcl2 G A 17: 50,611,001 V943M possibly damaging Het
Prkcd T A 14: 30,607,337 T164S probably damaging Het
Ptprn2 T A 12: 117,248,688 L910Q probably damaging Het
Rab1b T C 19: 5,104,895 I41V probably benign Het
Scpep1 T A 11: 88,933,445 probably null Het
Sergef T C 7: 46,590,756 T288A probably damaging Het
Setdb1 G A 3: 95,341,415 P397S probably damaging Het
Setx T A 2: 29,139,411 D230E probably damaging Het
Sin3a C A 9: 57,095,255 probably benign Het
Smad5 T C 13: 56,735,941 L380P probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stard9 A T 2: 120,702,194 probably benign Het
Tek A G 4: 94,827,263 D346G probably benign Het
Trav7d-4 T A 14: 52,769,896 W12R unknown Het
Trmt1l G T 1: 151,457,930 W728L probably damaging Het
Ubash3a C A 17: 31,239,224 T559K probably damaging Het
Vmn1r72 T A 7: 11,669,784 I246F possibly damaging Het
Zfp618 A T 4: 63,080,088 Q109L probably damaging Het
Other mutations in Olfr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Olfr33 APN 7 102713601 missense probably damaging 1.00
IGL02349:Olfr33 APN 7 102714126 missense probably damaging 0.99
IGL02739:Olfr33 APN 7 102714314 missense possibly damaging 0.58
IGL03110:Olfr33 APN 7 102713883 missense probably damaging 1.00
R0158:Olfr33 UTSW 7 102713955 missense probably benign 0.03
R1455:Olfr33 UTSW 7 102713998 nonsense probably null
R1996:Olfr33 UTSW 7 102713792 missense probably damaging 1.00
R2032:Olfr33 UTSW 7 102713876 missense probably benign 0.00
R2152:Olfr33 UTSW 7 102713581 missense probably benign 0.01
R4852:Olfr33 UTSW 7 102713543 missense probably damaging 0.99
R4965:Olfr33 UTSW 7 102713495 missense probably damaging 1.00
R5264:Olfr33 UTSW 7 102714351 missense probably benign 0.00
R5464:Olfr33 UTSW 7 102713682 missense probably benign
R6680:Olfr33 UTSW 7 102714315 missense possibly damaging 0.70
R7195:Olfr33 UTSW 7 102713666 missense possibly damaging 0.74
R7373:Olfr33 UTSW 7 102714099 missense possibly damaging 0.53
R7391:Olfr33 UTSW 7 102713982 missense probably benign 0.02
R7872:Olfr33 UTSW 7 102714182 missense probably benign 0.01
R7948:Olfr33 UTSW 7 102713688 missense probably benign 0.00
R8097:Olfr33 UTSW 7 102713990 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGAAGATGGTCTTTTCACAACTAG -3'
(R):5'- CCACAGTGGGTATAGACTCCTTG -3'

Sequencing Primer
(F):5'- AGCCTTTCCTACTTAGCAC -3'
(R):5'- ATTCTTCACACAGTCATGGGGCTAG -3'
Posted On2017-02-01