Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03014:Sin3a'

453321

Institutional Source

Beutler Lab

Gene Symbol

Sin3a

Ensembl Gene

ENSMUSG00000042557

Gene Name

transcriptional regulator, SIN3A (yeast)

Synonyms

Sin3, mSin3A

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

IGL03014 (G1)

Quality Score

190

Status

Validated

Chromosome

Chromosomal Location

57072040-57128366 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to A at 57095255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000163400] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]

AlphaFold

Q60520

Predicted Effect

probably benign
Transcript: ENSMUST00000049169

SMART Domains

Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125333

Predicted Effect

probably benign
Transcript: ENSMUST00000163400

SMART Domains

Protein: ENSMUSP00000126718
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
Pfam:PAH	82	128	2.1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165927

Predicted Effect

probably benign
Transcript: ENSMUST00000167715

SMART Domains

Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168177

SMART Domains

Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	142	186	5.3e-22	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	323	380	9.6e-22	PFAM
Pfam:PAH	479	523	8.1e-11	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
Pfam:Sin3a_C	887	1190	1.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168502

SMART Domains

Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1138	1154	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168678

SMART Domains

Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
Pfam:PAH	141	187	1.4e-19	PFAM
low complexity region	217	248	N/A	INTRINSIC
low complexity region	267	282	N/A	INTRINSIC
Pfam:PAH	322	381	1.8e-23	PFAM
Pfam:PAH	478	524	4e-16	PFAM
HDAC_interact	551	651	3.31e-61	SMART
low complexity region	834	847	N/A	INTRINSIC
low complexity region	915	930	N/A	INTRINSIC
low complexity region	1135	1151	N/A	INTRINSIC

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	A	G	14: 8,431,608	*675Q	probably null	Het
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
AW112010	A	G	19: 11,048,092		noncoding transcript	Het
BC003331	C	A	1: 150,383,053		probably benign	Het
Ccdc134	T	C	15: 82,130,105	L13P	probably damaging	Het
Ccdc150	G	T	1: 54,290,702	V395F	probably damaging	Het
Cdh22	G	T	2: 165,112,411	S730*	probably null	Het
Chrng	G	T	1: 87,211,037		probably null	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Csmd2	G	T	4: 128,296,429	M387I	probably benign	Het
Cux1	T	C	5: 136,565,525		probably benign	Het
D130043K22Rik	C	T	13: 24,858,092	P335S	possibly damaging	Het
Dctn1	A	G	6: 83,197,369		probably benign	Het
Dock11	G	T	X: 36,047,046		probably benign	Het
Dsn1	A	T	2: 156,996,819	M292K	possibly damaging	Het
Efemp1	A	G	11: 28,926,218	Y461C	probably damaging	Het
Efl1	A	G	7: 82,651,886	T33A	probably damaging	Het
Fbln2	T	C	6: 91,265,919		probably benign	Het
Fcna	G	C	2: 25,630,681		probably benign	Het
Hecw1	T	A	13: 14,245,808	Y1010F	probably damaging	Het
Igha	A	G	12: 113,259,093	V236A	unknown	Het
Igsf9b	T	C	9: 27,322,636	M377T	probably benign	Het
Itga9	A	G	9: 118,628,144	T108A	probably benign	Het
Kcna3	A	T	3: 107,037,890	M490L	probably benign	Het
Lama3	A	T	18: 12,539,967	Y886F	possibly damaging	Het
Lcorl	T	C	5: 45,774,029		probably benign	Het
Lyl1	C	T	8: 84,702,671	P3L	possibly damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Olfr33	A	T	7: 102,713,546	V289E	probably null	Het
Olfr43	G	A	11: 74,206,827	L130F	probably damaging	Het
Pex10	A	G	4: 155,070,619		probably benign	Het
Plcl2	G	A	17: 50,611,001	V943M	possibly damaging	Het
Prkcd	T	A	14: 30,607,337	T164S	probably damaging	Het
Ptprn2	T	A	12: 117,248,688	L910Q	probably damaging	Het
Rab1b	T	C	19: 5,104,895	I41V	probably benign	Het
Scpep1	T	A	11: 88,933,445		probably null	Het
Sergef	T	C	7: 46,590,756	T288A	probably damaging	Het
Setdb1	G	A	3: 95,341,415	P397S	probably damaging	Het
Setx	T	A	2: 29,139,411	D230E	probably damaging	Het
Smad5	T	C	13: 56,735,941	L380P	probably damaging	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Stard9	A	T	2: 120,702,194		probably benign	Het
Tek	A	G	4: 94,827,263	D346G	probably benign	Het
Trav7d-4	T	A	14: 52,769,896	W12R	unknown	Het
Trmt1l	G	T	1: 151,457,930	W728L	probably damaging	Het
Ubash3a	C	A	17: 31,239,224	T559K	probably damaging	Het
Vmn1r72	T	A	7: 11,669,784	I246F	possibly damaging	Het
Zfp618	A	T	4: 63,080,088	Q109L	probably damaging	Het

Other mutations in Sin3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Sin3a	APN	9	57097901	missense	probably damaging	1.00
IGL00836:Sin3a	APN	9	57107345	splice site	probably null
IGL00913:Sin3a	APN	9	57098118	missense	probably benign	0.01
IGL01721:Sin3a	APN	9	57095325	missense	probably damaging	1.00
IGL01964:Sin3a	APN	9	57107347	splice site	probably benign
IGL02333:Sin3a	APN	9	57107559	missense	possibly damaging	0.86
IGL02673:Sin3a	APN	9	57107441	missense	probably damaging	0.99
Crumbled	UTSW	9	57110654	nonsense	probably null
Delicate	UTSW	9	57103929	missense	probably damaging	1.00
PIT4519001:Sin3a	UTSW	9	57095456	missense	possibly damaging	0.86
R0024:Sin3a	UTSW	9	57118253	intron	probably benign
R0309:Sin3a	UTSW	9	57110912	missense	probably benign	0.00
R0511:Sin3a	UTSW	9	57096895	nonsense	probably null
R1205:Sin3a	UTSW	9	57119175	missense	probably damaging	1.00
R1365:Sin3a	UTSW	9	57125203	nonsense	probably null
R1496:Sin3a	UTSW	9	57119158	missense	possibly damaging	0.77
R1544:Sin3a	UTSW	9	57103997	splice site	probably benign
R1958:Sin3a	UTSW	9	57105609	missense	probably damaging	1.00
R1993:Sin3a	UTSW	9	57101199	missense	probably damaging	1.00
R2037:Sin3a	UTSW	9	57096825	missense	probably benign	0.14
R2065:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R2079:Sin3a	UTSW	9	57089523	missense	probably benign
R2193:Sin3a	UTSW	9	57117477	missense	possibly damaging	0.93
R3004:Sin3a	UTSW	9	57096834	nonsense	probably null
R3929:Sin3a	UTSW	9	57118137	missense	probably damaging	0.98
R4326:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4327:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4329:Sin3a	UTSW	9	57095358	missense	probably damaging	1.00
R4765:Sin3a	UTSW	9	57096803	missense	probably benign	0.14
R4806:Sin3a	UTSW	9	57086742	missense	probably damaging	0.99
R4979:Sin3a	UTSW	9	57118076	missense	probably damaging	1.00
R5018:Sin3a	UTSW	9	57110891	missense	probably benign	0.00
R5368:Sin3a	UTSW	9	57110800	missense	possibly damaging	0.93
R5379:Sin3a	UTSW	9	57110988	missense	probably benign	0.10
R5391:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5395:Sin3a	UTSW	9	57105673	missense	probably damaging	1.00
R5519:Sin3a	UTSW	9	57118173	critical splice donor site	probably null
R5927:Sin3a	UTSW	9	57111111	missense	probably damaging	1.00
R5987:Sin3a	UTSW	9	57127200	missense	possibly damaging	0.75
R6083:Sin3a	UTSW	9	57107540	missense	probably damaging	1.00
R6161:Sin3a	UTSW	9	57095424	missense	possibly damaging	0.48
R6196:Sin3a	UTSW	9	57103929	missense	probably damaging	1.00
R6374:Sin3a	UTSW	9	57117481	missense	probably benign
R6456:Sin3a	UTSW	9	57113701	missense	possibly damaging	0.79
R6815:Sin3a	UTSW	9	57117540	missense	probably benign	0.02
R6900:Sin3a	UTSW	9	57107574	missense	probably damaging	1.00
R7051:Sin3a	UTSW	9	57103934	missense	probably damaging	1.00
R7081:Sin3a	UTSW	9	57094471	missense	probably null	1.00
R7285:Sin3a	UTSW	9	57127299	missense	possibly damaging	0.57
R7462:Sin3a	UTSW	9	57095525	missense	probably benign	0.00
R7538:Sin3a	UTSW	9	57103926	missense	possibly damaging	0.95
R7699:Sin3a	UTSW	9	57110654	nonsense	probably null
R8150:Sin3a	UTSW	9	57127284	missense	possibly damaging	0.92
R8158:Sin3a	UTSW	9	57113544	critical splice acceptor site	probably null
R8717:Sin3a	UTSW	9	57127226	missense	probably damaging	0.99
R9048:Sin3a	UTSW	9	57125336	missense	probably damaging	0.99
R9283:Sin3a	UTSW	9	57095433	missense	probably damaging	0.99
R9300:Sin3a	UTSW	9	57107460	missense	probably damaging	1.00
R9330:Sin3a	UTSW	9	57125197	missense	probably damaging	1.00
R9396:Sin3a	UTSW	9	57101161	missense	probably benign	0.28
R9550:Sin3a	UTSW	9	57089484	missense	probably benign	0.00
R9746:Sin3a	UTSW	9	57118074	missense	probably benign	0.11
RF017:Sin3a	UTSW	9	57127326	missense	possibly damaging	0.90
X0026:Sin3a	UTSW	9	57125192	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCGGCTTAGGGACAGTTTTAG -3'
(R):5'- GTGGGAATCTGATGAACTTGGCC -3'

Sequencing Primer
(F):5'- AGGGACAGTTTTAGATGTACTACTG -3'
(R):5'- AATCTGATGAACTTGGCCAGGTG -3'

Posted On

2017-02-01