Incidental Mutation 'IGL03014:Scpep1'
ID453327
Institutional Source Beutler Lab
Gene Symbol Scpep1
Ensembl Gene ENSMUSG00000000278
Gene Nameserine carboxypeptidase 1
Synonyms4833411K15Rik, 2410018F01Rik, Risc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03014 (G1)
Quality Score20
Status Validated
Chromosome11
Chromosomal Location88924020-88955465 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 88933445 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000287]
Predicted Effect probably null
Transcript: ENSMUST00000000287
SMART Domains Protein: ENSMUSP00000000287
Gene: ENSMUSG00000000278

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_S10 29 451 2e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139592
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit no abnormal phenotype. Mice homozygous for a knock-out allele exhibit abnormal blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,608 *675Q probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
AW112010 A G 19: 11,048,092 noncoding transcript Het
BC003331 C A 1: 150,383,053 probably benign Het
Ccdc134 T C 15: 82,130,105 L13P probably damaging Het
Ccdc150 G T 1: 54,290,702 V395F probably damaging Het
Cdh22 G T 2: 165,112,411 S730* probably null Het
Chrng G T 1: 87,211,037 probably null Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd2 G T 4: 128,296,429 M387I probably benign Het
Cux1 T C 5: 136,565,525 probably benign Het
D130043K22Rik C T 13: 24,858,092 P335S possibly damaging Het
Dctn1 A G 6: 83,197,369 probably benign Het
Dock11 G T X: 36,047,046 probably benign Het
Dsn1 A T 2: 156,996,819 M292K possibly damaging Het
Efemp1 A G 11: 28,926,218 Y461C probably damaging Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Fbln2 T C 6: 91,265,919 probably benign Het
Fcna G C 2: 25,630,681 probably benign Het
Hecw1 T A 13: 14,245,808 Y1010F probably damaging Het
Igha A G 12: 113,259,093 V236A unknown Het
Igsf9b T C 9: 27,322,636 M377T probably benign Het
Itga9 A G 9: 118,628,144 T108A probably benign Het
Kcna3 A T 3: 107,037,890 M490L probably benign Het
Lama3 A T 18: 12,539,967 Y886F possibly damaging Het
Lcorl T C 5: 45,774,029 probably benign Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Olfr33 A T 7: 102,713,546 V289E probably null Het
Olfr43 G A 11: 74,206,827 L130F probably damaging Het
Pex10 A G 4: 155,070,619 probably benign Het
Plcl2 G A 17: 50,611,001 V943M possibly damaging Het
Prkcd T A 14: 30,607,337 T164S probably damaging Het
Ptprn2 T A 12: 117,248,688 L910Q probably damaging Het
Rab1b T C 19: 5,104,895 I41V probably benign Het
Sergef T C 7: 46,590,756 T288A probably damaging Het
Setdb1 G A 3: 95,341,415 P397S probably damaging Het
Setx T A 2: 29,139,411 D230E probably damaging Het
Sin3a C A 9: 57,095,255 probably benign Het
Smad5 T C 13: 56,735,941 L380P probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stard9 A T 2: 120,702,194 probably benign Het
Tek A G 4: 94,827,263 D346G probably benign Het
Trav7d-4 T A 14: 52,769,896 W12R unknown Het
Trmt1l G T 1: 151,457,930 W728L probably damaging Het
Ubash3a C A 17: 31,239,224 T559K probably damaging Het
Vmn1r72 T A 7: 11,669,784 I246F possibly damaging Het
Zfp618 A T 4: 63,080,088 Q109L probably damaging Het
Other mutations in Scpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Scpep1 APN 11 88952477 missense probably damaging 1.00
IGL01123:Scpep1 APN 11 88941328 missense possibly damaging 0.79
IGL02341:Scpep1 APN 11 88944488 missense probably benign 0.30
IGL03078:Scpep1 APN 11 88935831 missense possibly damaging 0.67
R1652:Scpep1 UTSW 11 88952434 nonsense probably null
R1966:Scpep1 UTSW 11 88952414 missense probably damaging 1.00
R4275:Scpep1 UTSW 11 88947142 splice site probably null
R4330:Scpep1 UTSW 11 88935903 nonsense probably null
R4331:Scpep1 UTSW 11 88935903 nonsense probably null
R4360:Scpep1 UTSW 11 88930244 missense possibly damaging 0.78
R4502:Scpep1 UTSW 11 88944385 missense probably benign 0.00
R4885:Scpep1 UTSW 11 88935911 missense probably benign 0.20
R4896:Scpep1 UTSW 11 88941296 missense probably damaging 1.00
R5010:Scpep1 UTSW 11 88941349 missense probably benign 0.30
R5229:Scpep1 UTSW 11 88937045 missense probably damaging 1.00
R5899:Scpep1 UTSW 11 88934576 critical splice donor site probably null
R5999:Scpep1 UTSW 11 88929313 missense possibly damaging 0.85
R6975:Scpep1 UTSW 11 88947205 missense probably damaging 0.98
R7098:Scpep1 UTSW 11 88929185 missense possibly damaging 0.59
R7637:Scpep1 UTSW 11 88929220 missense probably damaging 1.00
R7790:Scpep1 UTSW 11 88933521 missense possibly damaging 0.70
R8285:Scpep1 UTSW 11 88952467 missense probably damaging 1.00
R8750:Scpep1 UTSW 11 88944472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGTAATAGTCCTTATGCAACC -3'
(R):5'- TGTGGAGTTCTGATCTAGCCC -3'

Sequencing Primer
(F):5'- GTAATAGTCCTTATGCAACCAATCC -3'
(R):5'- GGAGTTCTGATCTAGCCCTTTGAC -3'
Posted On2017-02-01