Incidental Mutation 'IGL03014:Igha'
ID 453329
Institutional Source Beutler Lab
Gene Symbol Igha
Ensembl Gene ENSMUSG00000095079
Gene Name immunoglobulin heavy constant alpha
Synonyms IgA, Igh-2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # IGL03014 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 113219824-113223856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113222713 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 236 (V236A)
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000178282
AA Change: V236A
Predicted Effect unknown
Transcript: ENSMUST00000194738
AA Change: V236A
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Homozygous null mice have no detectable levels of IgA, decreased levels of IgG3, and increased levels of most other classes of immunoglobulins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
AW112010 A G 19: 11,025,456 (GRCm39) noncoding transcript Het
Ccdc134 T C 15: 82,014,306 (GRCm39) L13P probably damaging Het
Ccdc150 G T 1: 54,329,861 (GRCm39) V395F probably damaging Het
Cdh22 G T 2: 164,954,331 (GRCm39) S730* probably null Het
Cfap20dc A G 14: 8,431,608 (GRCm38) *675Q probably null Het
Chrng G T 1: 87,138,759 (GRCm39) probably null Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Csmd2 G T 4: 128,190,222 (GRCm39) M387I probably benign Het
Cux1 T C 5: 136,594,379 (GRCm39) probably benign Het
D130043K22Rik C T 13: 25,042,075 (GRCm39) P335S possibly damaging Het
Dctn1 A G 6: 83,174,351 (GRCm39) probably benign Het
Dock11 G T X: 35,310,699 (GRCm39) probably benign Het
Dsn1 A T 2: 156,838,739 (GRCm39) M292K possibly damaging Het
Efemp1 A G 11: 28,876,218 (GRCm39) Y461C probably damaging Het
Efl1 A G 7: 82,301,094 (GRCm39) T33A probably damaging Het
Fbln2 T C 6: 91,242,901 (GRCm39) probably benign Het
Fcna G C 2: 25,520,693 (GRCm39) probably benign Het
Hecw1 T A 13: 14,420,393 (GRCm39) Y1010F probably damaging Het
Igsf9b T C 9: 27,233,932 (GRCm39) M377T probably benign Het
Itga9 A G 9: 118,457,212 (GRCm39) T108A probably benign Het
Kcna3 A T 3: 106,945,206 (GRCm39) M490L probably benign Het
Lama3 A T 18: 12,673,024 (GRCm39) Y886F possibly damaging Het
Lcorl T C 5: 45,931,371 (GRCm39) probably benign Het
Lyl1 C T 8: 85,429,300 (GRCm39) P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Odr4 C A 1: 150,258,804 (GRCm39) probably benign Het
Or1a1b G A 11: 74,097,653 (GRCm39) L130F probably damaging Het
Or51a39 A T 7: 102,362,753 (GRCm39) V289E probably null Het
Pex10 A G 4: 155,155,076 (GRCm39) probably benign Het
Plcl2 G A 17: 50,918,029 (GRCm39) V943M possibly damaging Het
Prkcd T A 14: 30,329,294 (GRCm39) T164S probably damaging Het
Ptprn2 T A 12: 117,212,308 (GRCm39) L910Q probably damaging Het
Rab1b T C 19: 5,154,923 (GRCm39) I41V probably benign Het
Scpep1 T A 11: 88,824,271 (GRCm39) probably null Het
Sergef T C 7: 46,240,180 (GRCm39) T288A probably damaging Het
Setdb1 G A 3: 95,248,726 (GRCm39) P397S probably damaging Het
Setx T A 2: 29,029,423 (GRCm39) D230E probably damaging Het
Sin3a C A 9: 57,002,539 (GRCm39) probably benign Het
Smad5 T C 13: 56,883,754 (GRCm39) L380P probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Stard9 A T 2: 120,532,675 (GRCm39) probably benign Het
Tek A G 4: 94,715,500 (GRCm39) D346G probably benign Het
Trav7d-4 T A 14: 53,007,353 (GRCm39) W12R unknown Het
Trmt1l G T 1: 151,333,681 (GRCm39) W728L probably damaging Het
Ubash3a C A 17: 31,458,198 (GRCm39) T559K probably damaging Het
Vmn1r72 T A 7: 11,403,711 (GRCm39) I246F possibly damaging Het
Zfp618 A T 4: 62,998,325 (GRCm39) Q109L probably damaging Het
Other mutations in Igha
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0078:Igha UTSW 12 113,223,547 (GRCm39) splice site probably benign
R3973:Igha UTSW 12 113,219,972 (GRCm39) unclassified probably benign
R4131:Igha UTSW 12 113,222,449 (GRCm39) critical splice donor site probably benign
R4866:Igha UTSW 12 113,223,129 (GRCm39) missense probably benign 0.30
R5931:Igha UTSW 12 113,223,710 (GRCm39) missense probably benign 0.05
R6101:Igha UTSW 12 113,220,017 (GRCm39) unclassified probably benign
R7735:Igha UTSW 12 113,220,019 (GRCm39) critical splice acceptor site probably benign
R8172:Igha UTSW 12 113,223,592 (GRCm39) missense
R8738:Igha UTSW 12 113,223,144 (GRCm39) missense probably damaging 1.00
R8951:Igha UTSW 12 113,222,684 (GRCm39) missense
R8985:Igha UTSW 12 113,222,611 (GRCm39) missense
R9803:Igha UTSW 12 113,222,759 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GAGTACTGGTCACCCTGTTTCC -3'
(R):5'- ATGCTCAACTAACTGCTCCTG -3'

Sequencing Primer
(F):5'- GTTTCCAGAGTTCAGCTGATACACG -3'
(R):5'- CCTGTCCTTATATCACAGAGGG -3'
Posted On 2017-02-01