Incidental Mutation 'IGL03014:Ptprn2'
ID 453330
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # IGL03014 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117212308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 910 (L910Q)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably damaging
Transcript: ENSMUST00000070733
AA Change: L910Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: L910Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190132
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: L910Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: L910Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Meta Mutation Damage Score 0.9414 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
AW112010 A G 19: 11,025,456 (GRCm39) noncoding transcript Het
Ccdc134 T C 15: 82,014,306 (GRCm39) L13P probably damaging Het
Ccdc150 G T 1: 54,329,861 (GRCm39) V395F probably damaging Het
Cdh22 G T 2: 164,954,331 (GRCm39) S730* probably null Het
Cfap20dc A G 14: 8,431,608 (GRCm38) *675Q probably null Het
Chrng G T 1: 87,138,759 (GRCm39) probably null Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Csmd2 G T 4: 128,190,222 (GRCm39) M387I probably benign Het
Cux1 T C 5: 136,594,379 (GRCm39) probably benign Het
D130043K22Rik C T 13: 25,042,075 (GRCm39) P335S possibly damaging Het
Dctn1 A G 6: 83,174,351 (GRCm39) probably benign Het
Dock11 G T X: 35,310,699 (GRCm39) probably benign Het
Dsn1 A T 2: 156,838,739 (GRCm39) M292K possibly damaging Het
Efemp1 A G 11: 28,876,218 (GRCm39) Y461C probably damaging Het
Efl1 A G 7: 82,301,094 (GRCm39) T33A probably damaging Het
Fbln2 T C 6: 91,242,901 (GRCm39) probably benign Het
Fcna G C 2: 25,520,693 (GRCm39) probably benign Het
Hecw1 T A 13: 14,420,393 (GRCm39) Y1010F probably damaging Het
Igha A G 12: 113,222,713 (GRCm39) V236A unknown Het
Igsf9b T C 9: 27,233,932 (GRCm39) M377T probably benign Het
Itga9 A G 9: 118,457,212 (GRCm39) T108A probably benign Het
Kcna3 A T 3: 106,945,206 (GRCm39) M490L probably benign Het
Lama3 A T 18: 12,673,024 (GRCm39) Y886F possibly damaging Het
Lcorl T C 5: 45,931,371 (GRCm39) probably benign Het
Lyl1 C T 8: 85,429,300 (GRCm39) P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Odr4 C A 1: 150,258,804 (GRCm39) probably benign Het
Or1a1b G A 11: 74,097,653 (GRCm39) L130F probably damaging Het
Or51a39 A T 7: 102,362,753 (GRCm39) V289E probably null Het
Pex10 A G 4: 155,155,076 (GRCm39) probably benign Het
Plcl2 G A 17: 50,918,029 (GRCm39) V943M possibly damaging Het
Prkcd T A 14: 30,329,294 (GRCm39) T164S probably damaging Het
Rab1b T C 19: 5,154,923 (GRCm39) I41V probably benign Het
Scpep1 T A 11: 88,824,271 (GRCm39) probably null Het
Sergef T C 7: 46,240,180 (GRCm39) T288A probably damaging Het
Setdb1 G A 3: 95,248,726 (GRCm39) P397S probably damaging Het
Setx T A 2: 29,029,423 (GRCm39) D230E probably damaging Het
Sin3a C A 9: 57,002,539 (GRCm39) probably benign Het
Smad5 T C 13: 56,883,754 (GRCm39) L380P probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Stard9 A T 2: 120,532,675 (GRCm39) probably benign Het
Tek A G 4: 94,715,500 (GRCm39) D346G probably benign Het
Trav7d-4 T A 14: 53,007,353 (GRCm39) W12R unknown Het
Trmt1l G T 1: 151,333,681 (GRCm39) W728L probably damaging Het
Ubash3a C A 17: 31,458,198 (GRCm39) T559K probably damaging Het
Vmn1r72 T A 7: 11,403,711 (GRCm39) I246F possibly damaging Het
Zfp618 A T 4: 62,998,325 (GRCm39) Q109L probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGTCCCCACCAGGTCAATC -3'
(R):5'- ACCTGCAGAGCTCTACGATG -3'

Sequencing Primer
(F):5'- AGGTCAATCTAGTCTCTGAGCAC -3'
(R):5'- CACCTTTATCTGATGGACTGATGGAC -3'
Posted On 2017-02-01