Incidental Mutation 'IGL03014:Prkcd'
ID453335
Institutional Source Beutler Lab
Gene Symbol Prkcd
Ensembl Gene ENSMUSG00000021948
Gene Nameprotein kinase C, delta
SynonymsPkcd, D14Ertd420e, PKC[d], PKCdelta
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #IGL03014 (G1)
Quality Score207
Status Validated
Chromosome14
Chromosomal Location30595354-30626210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30607337 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 164 (T164S)
Ref Sequence ENSEMBL: ENSMUSP00000107830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022521] [ENSMUST00000112202] [ENSMUST00000112203] [ENSMUST00000112206] [ENSMUST00000112207] [ENSMUST00000112210] [ENSMUST00000112211]
Predicted Effect probably damaging
Transcript: ENSMUST00000022521
AA Change: T164S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022521
Gene: ENSMUSG00000021948
AA Change: T164S

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112202
AA Change: T49S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107821
Gene: ENSMUSG00000021948
AA Change: T49S

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112203
AA Change: T49S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107822
Gene: ENSMUSG00000021948
AA Change: T49S

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112206
AA Change: T49S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107825
Gene: ENSMUSG00000021948
AA Change: T49S

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
S_TK_X 513 576 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112207
AA Change: T49S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107826
Gene: ENSMUSG00000021948
AA Change: T49S

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
S_TK_X 487 550 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112208
SMART Domains Protein: ENSMUSP00000107827
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112210
AA Change: T164S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107829
Gene: ENSMUSG00000021948
AA Change: T164S

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112211
AA Change: T164S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107830
Gene: ENSMUSG00000021948
AA Change: T164S

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227078
Meta Mutation Damage Score 0.1769 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,608 *675Q probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
AW112010 A G 19: 11,048,092 noncoding transcript Het
BC003331 C A 1: 150,383,053 probably benign Het
Ccdc134 T C 15: 82,130,105 L13P probably damaging Het
Ccdc150 G T 1: 54,290,702 V395F probably damaging Het
Cdh22 G T 2: 165,112,411 S730* probably null Het
Chrng G T 1: 87,211,037 probably null Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd2 G T 4: 128,296,429 M387I probably benign Het
Cux1 T C 5: 136,565,525 probably benign Het
D130043K22Rik C T 13: 24,858,092 P335S possibly damaging Het
Dctn1 A G 6: 83,197,369 probably benign Het
Dock11 G T X: 36,047,046 probably benign Het
Dsn1 A T 2: 156,996,819 M292K possibly damaging Het
Efemp1 A G 11: 28,926,218 Y461C probably damaging Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Fbln2 T C 6: 91,265,919 probably benign Het
Fcna G C 2: 25,630,681 probably benign Het
Hecw1 T A 13: 14,245,808 Y1010F probably damaging Het
Igha A G 12: 113,259,093 V236A unknown Het
Igsf9b T C 9: 27,322,636 M377T probably benign Het
Itga9 A G 9: 118,628,144 T108A probably benign Het
Kcna3 A T 3: 107,037,890 M490L probably benign Het
Lama3 A T 18: 12,539,967 Y886F possibly damaging Het
Lcorl T C 5: 45,774,029 probably benign Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Olfr33 A T 7: 102,713,546 V289E probably null Het
Olfr43 G A 11: 74,206,827 L130F probably damaging Het
Pex10 A G 4: 155,070,619 probably benign Het
Plcl2 G A 17: 50,611,001 V943M possibly damaging Het
Ptprn2 T A 12: 117,248,688 L910Q probably damaging Het
Rab1b T C 19: 5,104,895 I41V probably benign Het
Scpep1 T A 11: 88,933,445 probably null Het
Sergef T C 7: 46,590,756 T288A probably damaging Het
Setdb1 G A 3: 95,341,415 P397S probably damaging Het
Setx T A 2: 29,139,411 D230E probably damaging Het
Sin3a C A 9: 57,095,255 probably benign Het
Smad5 T C 13: 56,735,941 L380P probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stard9 A T 2: 120,702,194 probably benign Het
Tek A G 4: 94,827,263 D346G probably benign Het
Trav7d-4 T A 14: 52,769,896 W12R unknown Het
Trmt1l G T 1: 151,457,930 W728L probably damaging Het
Ubash3a C A 17: 31,239,224 T559K probably damaging Het
Vmn1r72 T A 7: 11,669,784 I246F possibly damaging Het
Zfp618 A T 4: 63,080,088 Q109L probably damaging Het
Other mutations in Prkcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Prkcd APN 14 30602422 splice site probably benign
IGL00715:Prkcd APN 14 30596003 missense probably damaging 1.00
IGL01914:Prkcd APN 14 30607426 missense possibly damaging 0.49
IGL02177:Prkcd APN 14 30605887 missense probably damaging 1.00
IGL02547:Prkcd APN 14 30599469 missense probably damaging 1.00
IGL02681:Prkcd APN 14 30601233 critical splice acceptor site probably null
Rigged UTSW 14 30610301 start codon destroyed probably null 0.99
rigged2 UTSW 14 30599743 missense probably damaging 1.00
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R1385:Prkcd UTSW 14 30607405 missense probably damaging 1.00
R1567:Prkcd UTSW 14 30607448 missense probably benign 0.35
R2114:Prkcd UTSW 14 30605851 missense probably damaging 1.00
R2983:Prkcd UTSW 14 30599478 missense probably damaging 1.00
R3716:Prkcd UTSW 14 30599712 missense probably benign 0.00
R4162:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4164:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4180:Prkcd UTSW 14 30610304 utr 5 prime probably benign
R4637:Prkcd UTSW 14 30598765 missense probably benign 0.00
R4750:Prkcd UTSW 14 30610301 start codon destroyed probably null 0.99
R4756:Prkcd UTSW 14 30599666 missense probably benign 0.00
R4849:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4850:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4893:Prkcd UTSW 14 30599425 missense probably damaging 1.00
R4914:Prkcd UTSW 14 30605438 critical splice donor site probably null
R4925:Prkcd UTSW 14 30607613 missense probably damaging 0.98
R5644:Prkcd UTSW 14 30607413 missense probably benign 0.06
R5832:Prkcd UTSW 14 30605821 missense probably damaging 0.99
R5910:Prkcd UTSW 14 30595981 missense probably benign 0.01
R6049:Prkcd UTSW 14 30607297 missense possibly damaging 0.95
R6322:Prkcd UTSW 14 30599663 missense probably damaging 1.00
R7177:Prkcd UTSW 14 30599707 missense probably damaging 1.00
R7358:Prkcd UTSW 14 30605836 missense probably benign
R7494:Prkcd UTSW 14 30609193 missense probably benign 0.00
R7554:Prkcd UTSW 14 30609263 missense probably damaging 0.96
R7778:Prkcd UTSW 14 30605815 critical splice donor site probably null
R7810:Prkcd UTSW 14 30598450 splice site probably null
R8020:Prkcd UTSW 14 30609244 missense possibly damaging 0.58
R8145:Prkcd UTSW 14 30602062 missense probably benign 0.03
R8417:Prkcd UTSW 14 30609251 missense probably benign 0.36
Z1176:Prkcd UTSW 14 30610249 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACTTACGCCTGCATTTGTAGC -3'
(R):5'- AGCTGGAAACAACTCCCATGG -3'

Sequencing Primer
(F):5'- GCCTGCATTTGTAGCCTTGC -3'
(R):5'- ACAACTCCCATGGGGCTATGTTG -3'
Posted On2017-02-01