Incidental Mutation 'IGL03014:Plcl2'
ID453339
Institutional Source Beutler Lab
Gene Symbol Plcl2
Ensembl Gene ENSMUSG00000038910
Gene Namephospholipase C-like 2
SynonymsPRIP-2, Plce2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #IGL03014 (G1)
Quality Score174
Status Validated
Chromosome17
Chromosomal Location50509547-50688493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50611001 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 943 (V943M)
Ref Sequence ENSEMBL: ENSMUSP00000046584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043938]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043938
AA Change: V943M

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: V943M

DomainStartEndE-ValueType
low complexity region 20 49 N/A INTRINSIC
PH 143 254 2.88e-5 SMART
Pfam:EF-hand_like 344 426 3.7e-29 PFAM
PLCXc 427 571 2.19e-84 SMART
PLCYc 619 735 4.37e-61 SMART
C2 756 862 3.45e-19 SMART
Meta Mutation Damage Score 0.1626 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,608 *675Q probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
AW112010 A G 19: 11,048,092 noncoding transcript Het
BC003331 C A 1: 150,383,053 probably benign Het
Ccdc134 T C 15: 82,130,105 L13P probably damaging Het
Ccdc150 G T 1: 54,290,702 V395F probably damaging Het
Cdh22 G T 2: 165,112,411 S730* probably null Het
Chrng G T 1: 87,211,037 probably null Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd2 G T 4: 128,296,429 M387I probably benign Het
Cux1 T C 5: 136,565,525 probably benign Het
D130043K22Rik C T 13: 24,858,092 P335S possibly damaging Het
Dctn1 A G 6: 83,197,369 probably benign Het
Dock11 G T X: 36,047,046 probably benign Het
Dsn1 A T 2: 156,996,819 M292K possibly damaging Het
Efemp1 A G 11: 28,926,218 Y461C probably damaging Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Fbln2 T C 6: 91,265,919 probably benign Het
Fcna G C 2: 25,630,681 probably benign Het
Hecw1 T A 13: 14,245,808 Y1010F probably damaging Het
Igha A G 12: 113,259,093 V236A unknown Het
Igsf9b T C 9: 27,322,636 M377T probably benign Het
Itga9 A G 9: 118,628,144 T108A probably benign Het
Kcna3 A T 3: 107,037,890 M490L probably benign Het
Lama3 A T 18: 12,539,967 Y886F possibly damaging Het
Lcorl T C 5: 45,774,029 probably benign Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Olfr33 A T 7: 102,713,546 V289E probably null Het
Olfr43 G A 11: 74,206,827 L130F probably damaging Het
Pex10 A G 4: 155,070,619 probably benign Het
Prkcd T A 14: 30,607,337 T164S probably damaging Het
Ptprn2 T A 12: 117,248,688 L910Q probably damaging Het
Rab1b T C 19: 5,104,895 I41V probably benign Het
Scpep1 T A 11: 88,933,445 probably null Het
Sergef T C 7: 46,590,756 T288A probably damaging Het
Setdb1 G A 3: 95,341,415 P397S probably damaging Het
Setx T A 2: 29,139,411 D230E probably damaging Het
Sin3a C A 9: 57,095,255 probably benign Het
Smad5 T C 13: 56,735,941 L380P probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stard9 A T 2: 120,702,194 probably benign Het
Tek A G 4: 94,827,263 D346G probably benign Het
Trav7d-4 T A 14: 52,769,896 W12R unknown Het
Trmt1l G T 1: 151,457,930 W728L probably damaging Het
Ubash3a C A 17: 31,239,224 T559K probably damaging Het
Vmn1r72 T A 7: 11,669,784 I246F possibly damaging Het
Zfp618 A T 4: 63,080,088 Q109L probably damaging Het
Other mutations in Plcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Plcl2 APN 17 50606920 missense probably benign 0.01
IGL01746:Plcl2 APN 17 50607696 missense probably benign 0.00
IGL02227:Plcl2 APN 17 50606397 missense probably damaging 0.97
IGL02232:Plcl2 APN 17 50606641 missense possibly damaging 0.66
IGL02878:Plcl2 APN 17 50607355 missense probably damaging 1.00
IGL02985:Plcl2 APN 17 50687814 nonsense probably null
Parece UTSW 17 50607846 missense probably damaging 0.99
verdad UTSW 17 50608081 missense probably damaging 1.00
R0110:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0190:Plcl2 UTSW 17 50607643 missense probably benign
R0280:Plcl2 UTSW 17 50607034 missense probably damaging 1.00
R0414:Plcl2 UTSW 17 50607955 missense possibly damaging 0.90
R0450:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0760:Plcl2 UTSW 17 50608774 missense possibly damaging 0.82
R1134:Plcl2 UTSW 17 50608110 missense probably benign
R1168:Plcl2 UTSW 17 50607072 missense possibly damaging 0.49
R1381:Plcl2 UTSW 17 50607729 missense probably damaging 0.99
R1748:Plcl2 UTSW 17 50606798 missense probably benign
R1856:Plcl2 UTSW 17 50607850 missense probably benign 0.13
R1958:Plcl2 UTSW 17 50608081 missense probably damaging 1.00
R2016:Plcl2 UTSW 17 50606694 missense probably damaging 1.00
R2057:Plcl2 UTSW 17 50668111 splice site probably null
R2077:Plcl2 UTSW 17 50606829 missense probably benign
R2247:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R3083:Plcl2 UTSW 17 50687744 missense probably benign 0.06
R4153:Plcl2 UTSW 17 50606361 nonsense probably null
R4574:Plcl2 UTSW 17 50607846 missense probably damaging 0.99
R4870:Plcl2 UTSW 17 50607226 missense possibly damaging 0.46
R5030:Plcl2 UTSW 17 50607319 missense possibly damaging 0.92
R5330:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5331:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5503:Plcl2 UTSW 17 50509929 missense probably benign 0.00
R5920:Plcl2 UTSW 17 50608675 missense probably damaging 0.99
R6238:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R6378:Plcl2 UTSW 17 50668160 intron probably null
R6603:Plcl2 UTSW 17 50607117 missense probably benign 0.03
R6633:Plcl2 UTSW 17 50640140 missense probably benign 0.00
R7113:Plcl2 UTSW 17 50606464 missense probably damaging 1.00
R7466:Plcl2 UTSW 17 50608468 missense probably damaging 1.00
R7665:Plcl2 UTSW 17 50607157 missense probably benign 0.00
X0026:Plcl2 UTSW 17 50607560 missense probably benign 0.03
Z1088:Plcl2 UTSW 17 50606992 missense probably damaging 1.00
Z1176:Plcl2 UTSW 17 50608456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTCTGTCCACAAGCATG -3'
(R):5'- TTCTTCAGCACCTCAGGCAC -3'

Sequencing Primer
(F):5'- GCTCTAATGCCTGCAAAGGACTTG -3'
(R):5'- ACGATGGCTTGCAGCTC -3'
Posted On2017-02-01