Incidental Mutation 'R5047:Plscr3'
ID453352
Institutional Source Beutler Lab
Gene Symbol Plscr3
Ensembl Gene ENSMUSG00000019461
Gene Namephospholipid scramblase 3
Synonyms
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5047 (G1)
Quality Score64
Status Validated
Chromosome11
Chromosomal Location69846376-69852058 bp(+) (GRCm38)
Type of Mutationsplice site (1716 bp from exon)
DNA Base Change (assembly) A to G at 69850091 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001626] [ENSMUST00000019605] [ENSMUST00000108626] [ENSMUST00000108628] [ENSMUST00000108632] [ENSMUST00000108633] [ENSMUST00000152566] [ENSMUST00000156507]
Predicted Effect probably benign
Transcript: ENSMUST00000001626
SMART Domains Protein: ENSMUSP00000001626
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 440 4.11e-1 SMART
low complexity region 504 517 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000019605
AA Change: D251G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019605
Gene: ENSMUSG00000019461
AA Change: D251G

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108626
SMART Domains Protein: ENSMUSP00000104266
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 6e-6 BLAST
TyrKc 116 378 1.2e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108628
SMART Domains Protein: ENSMUSP00000104268
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 445 6.1e-1 SMART
low complexity region 509 522 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108632
AA Change: D251G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104272
Gene: ENSMUSG00000019461
AA Change: D251G

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108633
AA Change: D251G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104273
Gene: ENSMUSG00000019461
AA Change: D251G

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152566
SMART Domains Protein: ENSMUSP00000123549
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 224 2.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156507
SMART Domains Protein: ENSMUSP00000120585
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 76 8.4e-17 PFAM
Pfam:Pkinase 1 97 1.2e-6 PFAM
low complexity region 127 140 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
Meta Mutation Damage Score 0.8240 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype PHENOTYPE: Homozygous null mice display lipid-engorged adipocytes, increased abdominal fat stores, mild hyperglycemia, dyslipidemia, impaired glucose tolerance, insulin resistance, altered plasma adiponectin and leptin levels, and impaired insulin-stimulated glucose uptake by adipocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Plscr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Plscr3 APN 11 69847682 missense possibly damaging 0.54
IGL02496:Plscr3 APN 11 69847383 unclassified probably benign
R0256:Plscr3 UTSW 11 69850054 missense probably damaging 1.00
R0639:Plscr3 UTSW 11 69847994 missense probably benign 0.06
R3824:Plscr3 UTSW 11 69850138 missense probably benign 0.04
R3825:Plscr3 UTSW 11 69850138 missense probably benign 0.04
R3919:Plscr3 UTSW 11 69847410 unclassified probably benign
R6306:Plscr3 UTSW 11 69847646 splice site probably null
R6972:Plscr3 UTSW 11 69847958 missense probably damaging 1.00
R7358:Plscr3 UTSW 11 69847490 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCGAAGAGTTCCTGAGCAG -3'
(R):5'- TGTCGATCAGCTCTTAACTTAGC -3'

Sequencing Primer
(F):5'- CGAAGAGTTCCTGAGCAGTCTAC -3'
(R):5'- GATCAGCTCTTAACTTAGCTCTGAAC -3'
Posted On2017-02-01