Incidental Mutation 'R5047:Atg3'
ID453353
Institutional Source Beutler Lab
Gene Symbol Atg3
Ensembl Gene ENSMUSG00000022663
Gene Nameautophagy related 3
SynonymsPC3-96, 2610016C12Rik, Apg3l, APG3
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45158785-45188538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45178232 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 132 (D132E)
Ref Sequence ENSEMBL: ENSMUSP00000023343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023343]
Predicted Effect probably benign
Transcript: ENSMUST00000023343
AA Change: D132E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023343
Gene: ENSMUSG00000022663
AA Change: D132E

DomainStartEndE-ValueType
Pfam:Autophagy_N 8 153 1.4e-55 PFAM
Pfam:Autophagy_act_C 204 265 8.8e-23 PFAM
Pfam:Autophagy_C 286 310 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150390
Meta Mutation Damage Score 0.1689 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like-conjugating enzyme and is a component of ubiquitination-like systems involved in autophagy, the process of degradation, turnover and recycling of cytoplasmic constituents in eukaryotic cells. This protein is known to play a role in regulation of autophagy during cell death. A pseudogene of this gene is located on chromosome 20. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in T cells exhibit decreased autophagy, decreased T cell proliferation, and increased T cell apoptosis. Mice homozygous for a knock-out allele exhibit decreased birth weight, neonatal lethality and abnormal autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Atg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Atg3 APN 16 45183811 critical splice donor site probably null
IGL01298:Atg3 APN 16 45171673 missense possibly damaging 0.78
IGL02285:Atg3 APN 16 45178317 splice site probably benign
IGL02626:Atg3 APN 16 45183685 missense probably benign 0.04
R1494:Atg3 UTSW 16 45171760 splice site probably benign
R3625:Atg3 UTSW 16 45175261 missense probably benign 0.07
R3743:Atg3 UTSW 16 45178228 critical splice acceptor site probably null
R5235:Atg3 UTSW 16 45159157 missense probably benign 0.15
R6696:Atg3 UTSW 16 45175281 missense possibly damaging 0.93
R7276:Atg3 UTSW 16 45162442 missense possibly damaging 0.70
R8072:Atg3 UTSW 16 45187685 missense probably damaging 1.00
R8501:Atg3 UTSW 16 45182931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACATAAGAAGCACAGGCAGTC -3'
(R):5'- CACAAGGCTCTTAAATGTTAAGCC -3'

Sequencing Primer
(F):5'- CAGTCAGAGGAAGGAGATTTCTTC -3'
(R):5'- GCCAACAGAAAAGAATTCTTAGTCC -3'
Posted On2017-02-01