Incidental Mutation 'R5132:Tgm7'
ID 453356
Institutional Source Beutler Lab
Gene Symbol Tgm7
Ensembl Gene ENSMUSG00000079103
Gene Name transglutaminase 7
Synonyms TGz
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 120924046-120946877 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120934700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 93 (F93L)
Ref Sequence ENSEMBL: ENSMUSP00000106303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110675]
AlphaFold A2ART8
Predicted Effect probably damaging
Transcript: ENSMUST00000110675
AA Change: F93L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106303
Gene: ENSMUSG00000079103
AA Change: F93L

DomainStartEndE-ValueType
TGc 177 270 2.54e-42 SMART
SCOP:d1kv3a2 395 512 1e-33 SMART
Pfam:Transglut_C 514 612 1.7e-20 PFAM
Meta Mutation Damage Score 0.8715 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases (TGM; EC 2.3.2.13) are a family of structurally and functionally related enzymes that stabilize protein assemblies through the formation of gamma-glutamyl-epsilon lysine crosslinks. For additional background information on transglutaminases, see TGM1 (MIM 190195).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,469,402 (GRCm39) K785* probably null Het
Acad11 A T 9: 104,003,791 (GRCm39) I628L probably benign Het
Ago1 T C 4: 126,355,516 (GRCm39) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm39) probably benign Het
Calr3 C T 8: 73,185,212 (GRCm39) probably null Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cdc42ep3 C T 17: 79,642,803 (GRCm39) R39H probably damaging Het
Cyp2j5 T C 4: 96,517,733 (GRCm39) Y493C probably damaging Het
Ddx19b A T 8: 111,749,040 (GRCm39) D66E probably benign Het
Drosha A G 15: 12,837,377 (GRCm39) D287G unknown Het
Gm8888 A G 15: 96,664,892 (GRCm39) noncoding transcript Het
Gpr25 G T 1: 136,188,103 (GRCm39) A170E probably damaging Het
Gria1 A G 11: 57,180,225 (GRCm39) Y656C probably damaging Het
Grik5 C T 7: 24,764,629 (GRCm39) V145I probably benign Het
Htt T C 5: 35,063,023 (GRCm39) V2885A possibly damaging Het
Larp6 A G 9: 60,644,493 (GRCm39) E211G probably damaging Het
Magi1 C A 6: 93,660,072 (GRCm39) probably null Het
Mtbp A G 15: 55,421,965 (GRCm39) S63G possibly damaging Het
Ndor1 A T 2: 25,137,781 (GRCm39) S513T probably benign Het
Nsd3 A G 8: 26,168,855 (GRCm39) D670G possibly damaging Het
Or10ag56 A T 2: 87,139,282 (GRCm39) M50L probably damaging Het
Or4k49 T A 2: 111,495,344 (GRCm39) Y258N probably damaging Het
Or5e1 T C 7: 108,354,477 (GRCm39) V138A probably damaging Het
Pcdh7 T C 5: 57,885,463 (GRCm39) V1061A probably benign Het
Pdia4 A G 6: 47,773,669 (GRCm39) I560T probably benign Het
Pomt2 A G 12: 87,157,121 (GRCm39) F733L probably damaging Het
Pprc1 T C 19: 46,061,121 (GRCm39) probably benign Het
Prkca T C 11: 108,082,943 (GRCm39) probably benign Het
Pspc1 A T 14: 56,960,707 (GRCm39) S473T probably benign Het
Rgs12 A G 5: 35,147,156 (GRCm39) probably benign Het
Scn3a C T 2: 65,298,548 (GRCm39) V1384I probably benign Het
Serpinb6a C T 13: 34,102,305 (GRCm39) D307N probably benign Het
Smap2 T C 4: 120,830,370 (GRCm39) E255G possibly damaging Het
Spmip6 A G 4: 41,517,178 (GRCm39) probably benign Het
St7 A T 6: 17,854,956 (GRCm39) I298F probably damaging Het
Timm23 A T 14: 31,915,902 (GRCm39) D56E probably damaging Het
Tmem170 A T 8: 112,596,357 (GRCm39) M56K probably benign Het
Other mutations in Tgm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tgm7 APN 2 120,937,396 (GRCm39) missense probably benign 0.16
IGL01576:Tgm7 APN 2 120,931,514 (GRCm39) missense probably damaging 1.00
IGL01982:Tgm7 APN 2 120,924,106 (GRCm39) nonsense probably null
IGL02077:Tgm7 APN 2 120,934,316 (GRCm39) missense probably damaging 1.00
IGL02135:Tgm7 APN 2 120,929,519 (GRCm39) missense possibly damaging 0.75
R0063:Tgm7 UTSW 2 120,924,577 (GRCm39) missense probably benign 0.01
R0412:Tgm7 UTSW 2 120,931,546 (GRCm39) missense probably damaging 1.00
R1869:Tgm7 UTSW 2 120,931,570 (GRCm39) missense probably damaging 1.00
R2201:Tgm7 UTSW 2 120,929,062 (GRCm39) missense probably damaging 1.00
R2276:Tgm7 UTSW 2 120,929,045 (GRCm39) missense probably damaging 1.00
R2279:Tgm7 UTSW 2 120,929,045 (GRCm39) missense probably damaging 1.00
R2872:Tgm7 UTSW 2 120,940,174 (GRCm39) start gained probably benign
R2872:Tgm7 UTSW 2 120,940,174 (GRCm39) start gained probably benign
R4523:Tgm7 UTSW 2 120,929,069 (GRCm39) critical splice acceptor site probably null
R4688:Tgm7 UTSW 2 120,924,502 (GRCm39) missense probably benign 0.06
R4757:Tgm7 UTSW 2 120,926,870 (GRCm39) missense possibly damaging 0.75
R4858:Tgm7 UTSW 2 120,929,445 (GRCm39) critical splice donor site probably null
R5141:Tgm7 UTSW 2 120,931,480 (GRCm39) missense probably benign 0.05
R5424:Tgm7 UTSW 2 120,929,522 (GRCm39) missense probably damaging 1.00
R5911:Tgm7 UTSW 2 120,926,454 (GRCm39) missense probably benign 0.27
R6166:Tgm7 UTSW 2 120,929,539 (GRCm39) missense probably damaging 1.00
R6364:Tgm7 UTSW 2 120,926,878 (GRCm39) nonsense probably null
R6636:Tgm7 UTSW 2 120,931,571 (GRCm39) missense probably damaging 1.00
R6637:Tgm7 UTSW 2 120,931,571 (GRCm39) missense probably damaging 1.00
R6950:Tgm7 UTSW 2 120,924,128 (GRCm39) missense probably damaging 1.00
R7094:Tgm7 UTSW 2 120,929,489 (GRCm39) missense probably damaging 1.00
R7536:Tgm7 UTSW 2 120,926,878 (GRCm39) nonsense probably null
R7729:Tgm7 UTSW 2 120,924,191 (GRCm39) missense probably benign
R7822:Tgm7 UTSW 2 120,934,421 (GRCm39) missense probably benign
R8213:Tgm7 UTSW 2 120,931,545 (GRCm39) missense probably damaging 0.99
R8511:Tgm7 UTSW 2 120,924,141 (GRCm39) missense probably damaging 0.99
R9182:Tgm7 UTSW 2 120,926,980 (GRCm39) missense probably benign
R9490:Tgm7 UTSW 2 120,928,867 (GRCm39) missense probably damaging 0.99
R9573:Tgm7 UTSW 2 120,934,606 (GRCm39) missense probably benign
R9656:Tgm7 UTSW 2 120,940,191 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACATTCAGGAGATGACCAGGC -3'
(R):5'- TGCATTTCCATCAAGAATCACACAG -3'

Sequencing Primer
(F):5'- AGATGACCAGGCTGTCCTCAG -3'
(R):5'- TTGCACTTAAGAGCACTGGC -3'
Posted On 2017-02-02