Incidental Mutation 'R5132:Tgm7'
ID453356
Institutional Source Beutler Lab
Gene Symbol Tgm7
Ensembl Gene ENSMUSG00000079103
Gene Nametransglutaminase 7
SynonymsTGz
MMRRC Submission 042720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5132 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121093565-121109795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121104219 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 93 (F93L)
Ref Sequence ENSEMBL: ENSMUSP00000106303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110675]
Predicted Effect probably damaging
Transcript: ENSMUST00000110675
AA Change: F93L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106303
Gene: ENSMUSG00000079103
AA Change: F93L

DomainStartEndE-ValueType
TGc 177 270 2.54e-42 SMART
SCOP:d1kv3a2 395 512 1e-33 SMART
Pfam:Transglut_C 514 612 1.7e-20 PFAM
Meta Mutation Damage Score 0.8715 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases (TGM; EC 2.3.2.13) are a family of structurally and functionally related enzymes that stabilize protein assemblies through the formation of gamma-glutamyl-epsilon lysine crosslinks. For additional background information on transglutaminases, see TGM1 (MIM 190195).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,517,178 probably benign Het
Abl2 A T 1: 156,641,832 K785* probably null Het
Acad11 A T 9: 104,126,592 I628L probably benign Het
Ago1 T C 4: 126,461,723 I98V probably benign Het
Bach2 A G 4: 32,563,396 probably benign Het
Calr3 C T 8: 72,431,368 probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc42ep3 C T 17: 79,335,374 R39H probably damaging Het
Cyp2j5 T C 4: 96,629,496 Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 D66E probably benign Het
Drosha A G 15: 12,837,291 D287G unknown Het
Gm8888 A G 15: 96,767,011 noncoding transcript Het
Gpr25 G T 1: 136,260,365 A170E probably damaging Het
Gria1 A G 11: 57,289,399 Y656C probably damaging Het
Grik5 C T 7: 25,065,204 V145I probably benign Het
Htt T C 5: 34,905,679 V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 E211G probably damaging Het
Magi1 C A 6: 93,683,091 probably null Het
Mtbp A G 15: 55,558,569 S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 S513T probably benign Het
Nsd3 A G 8: 25,678,839 D670G possibly damaging Het
Olfr1118 A T 2: 87,308,938 M50L probably damaging Het
Olfr1299 T A 2: 111,664,999 Y258N probably damaging Het
Olfr513 T C 7: 108,755,270 V138A probably damaging Het
Pcdh7 T C 5: 57,728,121 V1061A probably benign Het
Pdia4 A G 6: 47,796,735 I560T probably benign Het
Pomt2 A G 12: 87,110,347 F733L probably damaging Het
Pprc1 T C 19: 46,072,682 probably benign Het
Prkca T C 11: 108,192,117 probably benign Het
Pspc1 A T 14: 56,723,250 S473T probably benign Het
Rgs12 A G 5: 34,989,812 probably benign Het
Scn3a C T 2: 65,468,204 V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 D307N probably benign Het
Smap2 T C 4: 120,973,173 E255G possibly damaging Het
St7 A T 6: 17,854,957 I298F probably damaging Het
Timm23 A T 14: 32,193,945 D56E probably damaging Het
Tmem170 A T 8: 111,869,725 M56K probably benign Het
Other mutations in Tgm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tgm7 APN 2 121106915 missense probably benign 0.16
IGL01576:Tgm7 APN 2 121101033 missense probably damaging 1.00
IGL01982:Tgm7 APN 2 121093625 nonsense probably null
IGL02077:Tgm7 APN 2 121103835 missense probably damaging 1.00
IGL02135:Tgm7 APN 2 121099038 missense possibly damaging 0.75
R0063:Tgm7 UTSW 2 121094096 missense probably benign 0.01
R0412:Tgm7 UTSW 2 121101065 missense probably damaging 1.00
R1869:Tgm7 UTSW 2 121101089 missense probably damaging 1.00
R2201:Tgm7 UTSW 2 121098581 missense probably damaging 1.00
R2276:Tgm7 UTSW 2 121098564 missense probably damaging 1.00
R2279:Tgm7 UTSW 2 121098564 missense probably damaging 1.00
R2872:Tgm7 UTSW 2 121109693 start gained probably benign
R2872:Tgm7 UTSW 2 121109693 start gained probably benign
R4523:Tgm7 UTSW 2 121098588 critical splice acceptor site probably null
R4688:Tgm7 UTSW 2 121094021 missense probably benign 0.06
R4757:Tgm7 UTSW 2 121096389 missense possibly damaging 0.75
R4858:Tgm7 UTSW 2 121098964 critical splice donor site probably null
R5141:Tgm7 UTSW 2 121100999 missense probably benign 0.05
R5424:Tgm7 UTSW 2 121099041 missense probably damaging 1.00
R5911:Tgm7 UTSW 2 121095973 missense probably benign 0.27
R6166:Tgm7 UTSW 2 121099058 missense probably damaging 1.00
R6364:Tgm7 UTSW 2 121096397 nonsense probably null
R6636:Tgm7 UTSW 2 121101090 missense probably damaging 1.00
R6637:Tgm7 UTSW 2 121101090 missense probably damaging 1.00
R6950:Tgm7 UTSW 2 121093647 missense probably damaging 1.00
R7094:Tgm7 UTSW 2 121099008 missense probably damaging 1.00
R7536:Tgm7 UTSW 2 121096397 nonsense probably null
R7729:Tgm7 UTSW 2 121093710 missense probably benign
R7822:Tgm7 UTSW 2 121103940 missense probably benign
R8213:Tgm7 UTSW 2 121101064 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATTCAGGAGATGACCAGGC -3'
(R):5'- TGCATTTCCATCAAGAATCACACAG -3'

Sequencing Primer
(F):5'- AGATGACCAGGCTGTCCTCAG -3'
(R):5'- TTGCACTTAAGAGCACTGGC -3'
Posted On2017-02-02