Incidental Mutation 'R5132:Timm23'
ID 453357
Institutional Source Beutler Lab
Gene Symbol Timm23
Ensembl Gene ENSMUSG00000013701
Gene Name translocase of inner mitochondrial membrane 23
Synonyms Tim23
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 31902123-31923848 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31915902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 56 (D56E)
Ref Sequence ENSEMBL: ENSMUSP00000154804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013845] [ENSMUST00000163379] [ENSMUST00000226683] [ENSMUST00000170331]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000013845
AA Change: D56E

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000013845
Gene: ENSMUSG00000013701
AA Change: D56E

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Pfam:Tim17 76 196 6.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104423
Predicted Effect probably benign
Transcript: ENSMUST00000163379
SMART Domains Protein: ENSMUSP00000129688
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172052
Predicted Effect probably damaging
Transcript: ENSMUST00000226683
AA Change: D56E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000170331
SMART Domains Protein: ENSMUSP00000126977
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Meta Mutation Damage Score 0.1458 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex located in the inner mitochondrial membrane that mediates the transport of transit peptide-containing proteins across the membrane. Multiple transcript variants, one protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die prior to E3.5. Mice heterogygous for this allele exhibit background sensitive premature aging and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,469,402 (GRCm39) K785* probably null Het
Acad11 A T 9: 104,003,791 (GRCm39) I628L probably benign Het
Ago1 T C 4: 126,355,516 (GRCm39) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm39) probably benign Het
Calr3 C T 8: 73,185,212 (GRCm39) probably null Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cdc42ep3 C T 17: 79,642,803 (GRCm39) R39H probably damaging Het
Cyp2j5 T C 4: 96,517,733 (GRCm39) Y493C probably damaging Het
Ddx19b A T 8: 111,749,040 (GRCm39) D66E probably benign Het
Drosha A G 15: 12,837,377 (GRCm39) D287G unknown Het
Gm8888 A G 15: 96,664,892 (GRCm39) noncoding transcript Het
Gpr25 G T 1: 136,188,103 (GRCm39) A170E probably damaging Het
Gria1 A G 11: 57,180,225 (GRCm39) Y656C probably damaging Het
Grik5 C T 7: 24,764,629 (GRCm39) V145I probably benign Het
Htt T C 5: 35,063,023 (GRCm39) V2885A possibly damaging Het
Larp6 A G 9: 60,644,493 (GRCm39) E211G probably damaging Het
Magi1 C A 6: 93,660,072 (GRCm39) probably null Het
Mtbp A G 15: 55,421,965 (GRCm39) S63G possibly damaging Het
Ndor1 A T 2: 25,137,781 (GRCm39) S513T probably benign Het
Nsd3 A G 8: 26,168,855 (GRCm39) D670G possibly damaging Het
Or10ag56 A T 2: 87,139,282 (GRCm39) M50L probably damaging Het
Or4k49 T A 2: 111,495,344 (GRCm39) Y258N probably damaging Het
Or5e1 T C 7: 108,354,477 (GRCm39) V138A probably damaging Het
Pcdh7 T C 5: 57,885,463 (GRCm39) V1061A probably benign Het
Pdia4 A G 6: 47,773,669 (GRCm39) I560T probably benign Het
Pomt2 A G 12: 87,157,121 (GRCm39) F733L probably damaging Het
Pprc1 T C 19: 46,061,121 (GRCm39) probably benign Het
Prkca T C 11: 108,082,943 (GRCm39) probably benign Het
Pspc1 A T 14: 56,960,707 (GRCm39) S473T probably benign Het
Rgs12 A G 5: 35,147,156 (GRCm39) probably benign Het
Scn3a C T 2: 65,298,548 (GRCm39) V1384I probably benign Het
Serpinb6a C T 13: 34,102,305 (GRCm39) D307N probably benign Het
Smap2 T C 4: 120,830,370 (GRCm39) E255G possibly damaging Het
Spmip6 A G 4: 41,517,178 (GRCm39) probably benign Het
St7 A T 6: 17,854,956 (GRCm39) I298F probably damaging Het
Tgm7 A G 2: 120,934,700 (GRCm39) F93L probably damaging Het
Tmem170 A T 8: 112,596,357 (GRCm39) M56K probably benign Het
Other mutations in Timm23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Timm23 APN 14 31,902,612 (GRCm39) missense probably benign 0.34
IGL02023:Timm23 APN 14 31,915,804 (GRCm39) splice site probably benign
R0666:Timm23 UTSW 14 31,920,993 (GRCm39) splice site probably benign
R2214:Timm23 UTSW 14 31,920,944 (GRCm39) missense probably damaging 0.98
R5161:Timm23 UTSW 14 31,915,882 (GRCm39) missense probably damaging 1.00
R5427:Timm23 UTSW 14 31,911,103 (GRCm39) missense possibly damaging 0.95
R6518:Timm23 UTSW 14 31,923,594 (GRCm39) splice site probably null
R7659:Timm23 UTSW 14 31,920,935 (GRCm39) nonsense probably null
R7692:Timm23 UTSW 14 31,902,520 (GRCm39) missense probably damaging 1.00
R9484:Timm23 UTSW 14 31,902,586 (GRCm39) missense probably benign 0.00
R9609:Timm23 UTSW 14 31,902,543 (GRCm39) missense probably benign 0.21
RF024:Timm23 UTSW 14 31,902,512 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- AACGACTTGGATTTAAGGACATTAC -3'
(R):5'- GGCTGTTATTGCAGACAATTTTAC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- CCAAACTACTTTGAAAATTTGACCTG -3'
Posted On 2017-02-02