Incidental Mutation 'R5080:Sp110'
ID453358
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R5080 (G1)
Quality Score28.1
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 85596055 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 18 (Y18*)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080204] [ENSMUST00000093508] [ENSMUST00000113385]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000080204
SMART Domains Protein: ENSMUSP00000079095
Gene: ENSMUSG00000070031

DomainStartEndE-ValueType
Pfam:Sp100 24 121 5.1e-40 PFAM
low complexity region 213 223 N/A INTRINSIC
low complexity region 240 248 N/A INTRINSIC
SAND 256 329 4.17e-34 SMART
PHD 360 402 3.7e-8 SMART
BROMO 423 526 4.49e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093508
AA Change: Y18*
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: Y18*

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162784
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCATGGTCAAGTTGGGCCTTC -3'
(R):5'- TTTGCTCTGTAGACAGCTAAGGG -3'

Sequencing Primer
(F):5'- CCATGTTCTAGAAACCCTGATGG -3'
(R):5'- GATGCTTGAAGACTAGGGTGTCTACC -3'
Posted On2017-02-02