Incidental Mutation 'IGL03055:Olfr656'
ID453384
Institutional Source Beutler Lab
Gene Symbol Olfr656
Ensembl Gene ENSMUSG00000073924
Gene Nameolfactory receptor 656
SynonymsGA_x6K02T2PBJ9-7245486-7246451, MOR27-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #IGL03055 (G1)
Quality Score220
Status Validated
Chromosome7
Chromosomal Location104613955-104621603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104618206 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 176 (I176F)
Ref Sequence ENSEMBL: ENSMUSP00000149625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098172] [ENSMUST00000215575]
Predicted Effect probably damaging
Transcript: ENSMUST00000098172
AA Change: I184F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095774
Gene: ENSMUSG00000073924
AA Change: I184F

DomainStartEndE-ValueType
Pfam:7tm_4 41 319 5.2e-105 PFAM
Pfam:7TM_GPCR_Srsx 42 316 1.1e-8 PFAM
Pfam:7tm_1 51 302 4.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210687
AA Change: I176F
Predicted Effect probably damaging
Transcript: ENSMUST00000215575
AA Change: I176F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900041M22Rik T A 11: 117,612,246 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A430005L14Rik T A 4: 153,960,635 S40R probably benign Het
Aire A G 10: 78,043,069 L48P probably damaging Het
Alkbh8 T C 9: 3,345,882 probably benign Het
Aqp7 A G 4: 41,045,326 M18T probably benign Het
Cchcr1 T A 17: 35,526,619 M406K probably benign Het
Cdhr1 A T 14: 37,095,097 D102E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Clec16a T A 16: 10,741,781 S973T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd1 A G 8: 16,095,501 Y1471H probably damaging Het
Dnah12 A G 14: 26,872,740 Y3489C probably damaging Het
Ect2 T C 3: 27,137,062 E464G probably damaging Het
Enpp2 C A 15: 54,866,085 probably null Het
Erich2 G T 2: 70,509,185 C28F possibly damaging Het
Fam135b A T 15: 71,622,034 H15Q possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Gfral T A 9: 76,208,549 T48S probably benign Het
Itga10 A G 3: 96,650,520 E293G probably damaging Het
Lrp2 A T 2: 69,458,448 N3691K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nefm T C 14: 68,122,909 T371A probably damaging Het
Nkain3 C A 4: 20,778,308 C3F probably benign Het
Nol4l G C 2: 153,436,270 silent Het
Nprl3 C A 11: 32,248,230 probably benign Het
Pate2 T C 9: 35,611,773 probably benign Het
Pde4d A G 13: 109,935,345 K128R probably damaging Het
Ptprt A G 2: 161,533,613 L1329P probably damaging Het
Rapgef3 T C 15: 97,749,489 probably benign Het
Rassf5 T C 1: 131,244,995 I46V probably benign Het
Rin1 C T 19: 5,053,159 T481I probably benign Het
Samd4b A G 7: 28,405,546 L524P possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Srebf1 T C 11: 60,207,076 silent Het
Ssh2 C T 11: 77,408,195 Q123* probably null Het
St18 G T 1: 6,802,735 L231F probably damaging Het
Stk11 A C 10: 80,128,086 D96A probably damaging Het
Svil A G 18: 5,108,615 T1918A probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tlr1 C A 5: 64,926,596 V213F probably benign Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wnt6 G A 1: 74,782,854 R198H probably damaging Het
Yipf2 A T 9: 21,589,723 V98E probably benign Het
Zc3h15 A G 2: 83,661,171 T248A possibly damaging Het
Zc3hav1 C T 6: 38,316,316 probably null Het
Zfp697 T G 3: 98,425,494 C79G possibly damaging Het
Other mutations in Olfr656
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Olfr656 APN 7 104617721 missense probably damaging 0.98
IGL01908:Olfr656 APN 7 104617699 missense probably damaging 1.00
IGL02695:Olfr656 APN 7 104618471 missense probably damaging 1.00
R0128:Olfr656 UTSW 7 104618581 missense probably damaging 1.00
R0184:Olfr656 UTSW 7 104618240 missense probably damaging 1.00
R4674:Olfr656 UTSW 7 104618424 nonsense probably null
R4675:Olfr656 UTSW 7 104618424 nonsense probably null
R4723:Olfr656 UTSW 7 104618489 missense possibly damaging 0.56
R4979:Olfr656 UTSW 7 104618605 missense probably null 0.03
R6273:Olfr656 UTSW 7 104617895 missense probably damaging 1.00
R6359:Olfr656 UTSW 7 104618303 missense probably damaging 1.00
R6582:Olfr656 UTSW 7 104618441 missense probably damaging 1.00
R6750:Olfr656 UTSW 7 104618113 missense probably damaging 0.99
R7426:Olfr656 UTSW 7 104617852 missense probably damaging 1.00
R7786:Olfr656 UTSW 7 104617718 missense probably benign 0.02
R8068:Olfr656 UTSW 7 104618253 nonsense probably null
X0065:Olfr656 UTSW 7 104617758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGAGTCCACAGTGCTG -3'
(R):5'- CCACAGGTACCTAAGGCTTTGG -3'

Sequencing Primer
(F):5'- CACAGTGCTGTTGGCCATG -3'
(R):5'- TACCTAAGGCTTTGGACCGG -3'
Posted On2017-02-03