Incidental Mutation 'IGL03055:Mmp1a'
ID453386
Institutional Source Beutler Lab
Gene Symbol Mmp1a
Ensembl Gene ENSMUSG00000043089
Gene Namematrix metallopeptidase 1a (interstitial collagenase)
SynonymsMcol-A
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #IGL03055 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location7464141-7476869 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TG to TGG at 7465083 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034492] [ENSMUST00000217651]
Predicted Effect probably null
Transcript: ENSMUST00000034492
SMART Domains Protein: ENSMUSP00000034492
Gene: ENSMUSG00000043089

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 25 84 8.2e-14 PFAM
ZnMc 97 259 2.99e-44 SMART
HX 281 323 8.12e-6 SMART
HX 325 369 7.81e-8 SMART
HX 374 421 5.82e-16 SMART
HX 423 463 2.18e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217651
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens. Mice lacking the encoded protein exhibit decreased susceptibility to chemical carcinogen-induced lung tumor development and angiogenesis. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced inflammatory response following chemical induction of tumors and male mice exhibit fewer large induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900041M22Rik T A 11: 117,612,246 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A430005L14Rik T A 4: 153,960,635 S40R probably benign Het
Aire A G 10: 78,043,069 L48P probably damaging Het
Alkbh8 T C 9: 3,345,882 probably benign Het
Aqp7 A G 4: 41,045,326 M18T probably benign Het
Cchcr1 T A 17: 35,526,619 M406K probably benign Het
Cdhr1 A T 14: 37,095,097 D102E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Clec16a T A 16: 10,741,781 S973T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd1 A G 8: 16,095,501 Y1471H probably damaging Het
Dnah12 A G 14: 26,872,740 Y3489C probably damaging Het
Ect2 T C 3: 27,137,062 E464G probably damaging Het
Enpp2 C A 15: 54,866,085 probably null Het
Erich2 G T 2: 70,509,185 C28F possibly damaging Het
Fam135b A T 15: 71,622,034 H15Q possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Gfral T A 9: 76,208,549 T48S probably benign Het
Itga10 A G 3: 96,650,520 E293G probably damaging Het
Lrp2 A T 2: 69,458,448 N3691K probably damaging Het
Nefm T C 14: 68,122,909 T371A probably damaging Het
Nkain3 C A 4: 20,778,308 C3F probably benign Het
Nol4l G C 2: 153,436,270 silent Het
Nprl3 C A 11: 32,248,230 probably benign Het
Olfr656 A T 7: 104,618,206 I176F probably damaging Het
Pate2 T C 9: 35,611,773 probably benign Het
Pde4d A G 13: 109,935,345 K128R probably damaging Het
Ptprt A G 2: 161,533,613 L1329P probably damaging Het
Rapgef3 T C 15: 97,749,489 probably benign Het
Rassf5 T C 1: 131,244,995 I46V probably benign Het
Rin1 C T 19: 5,053,159 T481I probably benign Het
Samd4b A G 7: 28,405,546 L524P possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Srebf1 T C 11: 60,207,076 silent Het
Ssh2 C T 11: 77,408,195 Q123* probably null Het
St18 G T 1: 6,802,735 L231F probably damaging Het
Stk11 A C 10: 80,128,086 D96A probably damaging Het
Svil A G 18: 5,108,615 T1918A probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tlr1 C A 5: 64,926,596 V213F probably benign Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wnt6 G A 1: 74,782,854 R198H probably damaging Het
Yipf2 A T 9: 21,589,723 V98E probably benign Het
Zc3h15 A G 2: 83,661,171 T248A possibly damaging Het
Zc3hav1 C T 6: 38,316,316 probably null Het
Zfp697 T G 3: 98,425,494 C79G possibly damaging Het
Other mutations in Mmp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Mmp1a APN 9 7476259 missense probably benign 0.04
IGL02179:Mmp1a APN 9 7464273 missense probably benign 0.23
IGL02738:Mmp1a APN 9 7464301 splice site probably benign
IGL02984:Mmp1a UTSW 9 7465083 makesense probably null
IGL02988:Mmp1a UTSW 9 7465083 makesense probably null
IGL02991:Mmp1a UTSW 9 7465083 makesense probably null
IGL03014:Mmp1a UTSW 9 7465083 makesense probably null
IGL03050:Mmp1a UTSW 9 7465083 makesense probably null
IGL03054:Mmp1a UTSW 9 7465083 makesense probably null
IGL03097:Mmp1a UTSW 9 7465083 makesense probably null
IGL03098:Mmp1a UTSW 9 7465083 makesense probably null
IGL03134:Mmp1a UTSW 9 7465083 makesense probably null
IGL03138:Mmp1a UTSW 9 7465083 makesense probably null
IGL03147:Mmp1a UTSW 9 7465083 makesense probably null
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R1422:Mmp1a UTSW 9 7464298 splice site probably null
R1663:Mmp1a UTSW 9 7465656 missense probably benign 0.33
R1801:Mmp1a UTSW 9 7475390 missense probably damaging 1.00
R2171:Mmp1a UTSW 9 7475356 missense probably damaging 0.99
R3415:Mmp1a UTSW 9 7464869 missense possibly damaging 0.92
R3901:Mmp1a UTSW 9 7475345 makesense probably null
R4175:Mmp1a UTSW 9 7467235 missense probably benign 0.03
R5406:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R6462:Mmp1a UTSW 9 7467038 missense probably benign 0.01
R7016:Mmp1a UTSW 9 7465083 makesense probably null
R7039:Mmp1a UTSW 9 7465083 makesense probably null
R7098:Mmp1a UTSW 9 7475937 missense probably benign 0.00
R7144:Mmp1a UTSW 9 7475318 missense probably damaging 1.00
R7196:Mmp1a UTSW 9 7476017 nonsense probably null
R7284:Mmp1a UTSW 9 7465083 makesense probably null
R7289:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R7313:Mmp1a UTSW 9 7465083 makesense probably null
R7510:Mmp1a UTSW 9 7465083 makesense probably null
R7537:Mmp1a UTSW 9 7465083 makesense probably null
R7574:Mmp1a UTSW 9 7465083 makesense probably null
R7626:Mmp1a UTSW 9 7465083 makesense probably null
R7755:Mmp1a UTSW 9 7467004 missense possibly damaging 0.92
R7789:Mmp1a UTSW 9 7475265 missense possibly damaging 0.70
R7791:Mmp1a UTSW 9 7465083 makesense probably null
R7900:Mmp1a UTSW 9 7465083 makesense probably null
R8000:Mmp1a UTSW 9 7476214 missense probably benign 0.11
R8009:Mmp1a UTSW 9 7467235 missense possibly damaging 0.76
R8039:Mmp1a UTSW 9 7465083 makesense probably null
R8072:Mmp1a UTSW 9 7465083 makesense probably null
RF004:Mmp1a UTSW 9 7465083 makesense probably null
X0020:Mmp1a UTSW 9 7465626 missense probably damaging 1.00
Z1177:Mmp1a UTSW 9 7464230 missense probably benign 0.21
Z1177:Mmp1a UTSW 9 7467033 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCTGGAAAACTACTACAACTTGGG -3'
(R):5'- TCCAGACTCTAAAGGCTCTCG -3'

Sequencing Primer
(F):5'- TACTACAACTTGGGCAAAAACATG -3'
(R):5'- AGACTCTAAAGGCTCTCGCGATG -3'
Posted On2017-02-03