Incidental Mutation 'IGL03055:Gfral'
ID453389
Institutional Source Beutler Lab
Gene Symbol Gfral
Ensembl Gene ENSMUSG00000059383
Gene NameGDNF family receptor alpha like
SynonymsGRAL
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #IGL03055 (G1)
Quality Score158
Status Validated
Chromosome9
Chromosomal Location76164102-76213657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76208549 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 48 (T48S)
Ref Sequence ENSEMBL: ENSMUSP00000139120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074880] [ENSMUST00000184693]
Predicted Effect probably benign
Transcript: ENSMUST00000074880
AA Change: T48S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074421
Gene: ENSMUSG00000059383
AA Change: T48S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
GDNF 220 316 3.15e-17 SMART
transmembrane domain 351 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184693
AA Change: T48S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139120
Gene: ENSMUSG00000059383
AA Change: T48S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased susceptibility to diet-induced obesity caused by overeating and reduced glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900041M22Rik T A 11: 117,612,246 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A430005L14Rik T A 4: 153,960,635 S40R probably benign Het
Aire A G 10: 78,043,069 L48P probably damaging Het
Alkbh8 T C 9: 3,345,882 probably benign Het
Aqp7 A G 4: 41,045,326 M18T probably benign Het
Cchcr1 T A 17: 35,526,619 M406K probably benign Het
Cdhr1 A T 14: 37,095,097 D102E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Clec16a T A 16: 10,741,781 S973T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd1 A G 8: 16,095,501 Y1471H probably damaging Het
Dnah12 A G 14: 26,872,740 Y3489C probably damaging Het
Ect2 T C 3: 27,137,062 E464G probably damaging Het
Enpp2 C A 15: 54,866,085 probably null Het
Erich2 G T 2: 70,509,185 C28F possibly damaging Het
Fam135b A T 15: 71,622,034 H15Q possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Itga10 A G 3: 96,650,520 E293G probably damaging Het
Lrp2 A T 2: 69,458,448 N3691K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nefm T C 14: 68,122,909 T371A probably damaging Het
Nkain3 C A 4: 20,778,308 C3F probably benign Het
Nol4l G C 2: 153,436,270 silent Het
Nprl3 C A 11: 32,248,230 probably benign Het
Olfr656 A T 7: 104,618,206 I176F probably damaging Het
Pate2 T C 9: 35,611,773 probably benign Het
Pde4d A G 13: 109,935,345 K128R probably damaging Het
Ptprt A G 2: 161,533,613 L1329P probably damaging Het
Rapgef3 T C 15: 97,749,489 probably benign Het
Rassf5 T C 1: 131,244,995 I46V probably benign Het
Rin1 C T 19: 5,053,159 T481I probably benign Het
Samd4b A G 7: 28,405,546 L524P possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Srebf1 T C 11: 60,207,076 silent Het
Ssh2 C T 11: 77,408,195 Q123* probably null Het
St18 G T 1: 6,802,735 L231F probably damaging Het
Stk11 A C 10: 80,128,086 D96A probably damaging Het
Svil A G 18: 5,108,615 T1918A probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tlr1 C A 5: 64,926,596 V213F probably benign Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wnt6 G A 1: 74,782,854 R198H probably damaging Het
Yipf2 A T 9: 21,589,723 V98E probably benign Het
Zc3h15 A G 2: 83,661,171 T248A possibly damaging Het
Zc3hav1 C T 6: 38,316,316 probably null Het
Zfp697 T G 3: 98,425,494 C79G possibly damaging Het
Other mutations in Gfral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Gfral APN 9 76164825 nonsense probably null
IGL02383:Gfral APN 9 76197092 missense probably damaging 0.97
IGL02987:Gfral APN 9 76197301 missense possibly damaging 0.82
IGL03002:Gfral APN 9 76197238 missense possibly damaging 0.61
PIT4585001:Gfral UTSW 9 76197294 missense probably damaging 1.00
R0268:Gfral UTSW 9 76197101 missense probably damaging 1.00
R0547:Gfral UTSW 9 76208642 missense probably benign 0.16
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1275:Gfral UTSW 9 76197032 missense probably damaging 1.00
R1830:Gfral UTSW 9 76193203 missense probably benign 0.01
R2249:Gfral UTSW 9 76193349 missense probably damaging 1.00
R3709:Gfral UTSW 9 76193443 nonsense probably null
R4712:Gfral UTSW 9 76193445 missense possibly damaging 0.71
R5567:Gfral UTSW 9 76208618 missense probably benign 0.00
R5568:Gfral UTSW 9 76164805 makesense probably null
R5719:Gfral UTSW 9 76197046 missense probably benign 0.02
R5789:Gfral UTSW 9 76197046 missense probably benign 0.02
R5791:Gfral UTSW 9 76197046 missense probably benign 0.02
R7110:Gfral UTSW 9 76164830 missense possibly damaging 0.84
R7549:Gfral UTSW 9 76198975 missense probably benign 0.14
R7782:Gfral UTSW 9 76193290 missense probably benign 0.43
R7851:Gfral UTSW 9 76205455 missense probably benign 0.03
Z1177:Gfral UTSW 9 76205389 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TACTGACAATGAGCCAAGTGAG -3'
(R):5'- CTCCATCTAGTTCCAGTGGTG -3'

Sequencing Primer
(F):5'- GCCAAGTGAGTATCAAGATTAAGTG -3'
(R):5'- TCCTCACTGATTTCCACAAAGG -3'
Posted On2017-02-03