Incidental Mutation 'IGL03055:Stk11'
ID453393
Institutional Source Beutler Lab
Gene Symbol Stk11
Ensembl Gene ENSMUSG00000003068
Gene Nameserine/threonine kinase 11
SynonymsPar-4, Lkb1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03055 (G1)
Quality Score106
Status Validated
Chromosome10
Chromosomal Location80115803-80130682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80128086 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 96 (D96A)
Ref Sequence ENSEMBL: ENSMUSP00000118853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003152] [ENSMUST00000105369] [ENSMUST00000105370] [ENSMUST00000105371] [ENSMUST00000144883] [ENSMUST00000147778] [ENSMUST00000152592] [ENSMUST00000213772] [ENSMUST00000170219] [ENSMUST00000169546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003152
AA Change: D368A

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003152
Gene: ENSMUSG00000003068
AA Change: D368A

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105369
SMART Domains Protein: ENSMUSP00000101008
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105370
AA Change: D242A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101009
Gene: ENSMUSG00000003068
AA Change: D242A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 180 2.8e-22 PFAM
Pfam:Pkinase 1 183 2.8e-40 PFAM
Pfam:Kinase-like 8 171 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144119
Predicted Effect possibly damaging
Transcript: ENSMUST00000144883
AA Change: D368A

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114195
Gene: ENSMUSG00000003068
AA Change: D368A

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
low complexity region 396 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146180
Predicted Effect probably benign
Transcript: ENSMUST00000147778
SMART Domains Protein: ENSMUSP00000130389
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152592
AA Change: D96A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118853
Gene: ENSMUSG00000003068
AA Change: D96A

DomainStartEndE-ValueType
Blast:S_TKc 1 53 6e-31 BLAST
PDB:2WTK|F 1 74 1e-40 PDB
SCOP:d1koba_ 1 89 1e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213772
AA Change: D368A

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000170219
SMART Domains Protein: ENSMUSP00000131487
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169546
SMART Domains Protein: ENSMUSP00000132978
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
low complexity region 276 284 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 451 491 N/A INTRINSIC
low complexity region 522 541 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
low complexity region 634 658 N/A INTRINSIC
Meta Mutation Damage Score 0.1870 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a member of the serine/threonine kinase family. The encoded protein, a known tumor suppressor, activates (via phosphorylation) adenine monophosphate-activated protein kinase (AMPK) and AMPK-related kinase proteins. This upstream regulation of the AMPK pathway is thought to regulate a number of different processes, including cell metabolism, cell polarity, apoptosis and DNA damage response. Mutations in a similar gene in human have been associated with Peutz-Jeghers syndrome. Alternative splicing results in multiple transcript variants, including the S isoform which plays a potential role in spermiogenesis. [provided by RefSeq, Sep 2014]
PHENOTYPE: Targeted heterozygous mutants with one inactivated allele develop benign gastrointestinal polyps. Homozygous null mutant are embryonic lethal. Homozygotes for a hypomorphic allele survive and apparently normal, but male mice are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900041M22Rik T A 11: 117,612,246 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A430005L14Rik T A 4: 153,960,635 S40R probably benign Het
Aire A G 10: 78,043,069 L48P probably damaging Het
Alkbh8 T C 9: 3,345,882 probably benign Het
Aqp7 A G 4: 41,045,326 M18T probably benign Het
Cchcr1 T A 17: 35,526,619 M406K probably benign Het
Cdhr1 A T 14: 37,095,097 D102E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Clec16a T A 16: 10,741,781 S973T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd1 A G 8: 16,095,501 Y1471H probably damaging Het
Dnah12 A G 14: 26,872,740 Y3489C probably damaging Het
Ect2 T C 3: 27,137,062 E464G probably damaging Het
Enpp2 C A 15: 54,866,085 probably null Het
Erich2 G T 2: 70,509,185 C28F possibly damaging Het
Fam135b A T 15: 71,622,034 H15Q possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Gfral T A 9: 76,208,549 T48S probably benign Het
Itga10 A G 3: 96,650,520 E293G probably damaging Het
Lrp2 A T 2: 69,458,448 N3691K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nefm T C 14: 68,122,909 T371A probably damaging Het
Nkain3 C A 4: 20,778,308 C3F probably benign Het
Nol4l G C 2: 153,436,270 silent Het
Nprl3 C A 11: 32,248,230 probably benign Het
Olfr656 A T 7: 104,618,206 I176F probably damaging Het
Pate2 T C 9: 35,611,773 probably benign Het
Pde4d A G 13: 109,935,345 K128R probably damaging Het
Ptprt A G 2: 161,533,613 L1329P probably damaging Het
Rapgef3 T C 15: 97,749,489 probably benign Het
Rassf5 T C 1: 131,244,995 I46V probably benign Het
Rin1 C T 19: 5,053,159 T481I probably benign Het
Samd4b A G 7: 28,405,546 L524P possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Srebf1 T C 11: 60,207,076 silent Het
Ssh2 C T 11: 77,408,195 Q123* probably null Het
St18 G T 1: 6,802,735 L231F probably damaging Het
Svil A G 18: 5,108,615 T1918A probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tlr1 C A 5: 64,926,596 V213F probably benign Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wnt6 G A 1: 74,782,854 R198H probably damaging Het
Yipf2 A T 9: 21,589,723 V98E probably benign Het
Zc3h15 A G 2: 83,661,171 T248A possibly damaging Het
Zc3hav1 C T 6: 38,316,316 probably null Het
Zfp697 T G 3: 98,425,494 C79G possibly damaging Het
Other mutations in Stk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02695:Stk11 APN 10 80125477 critical splice acceptor site probably null
R0450:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0469:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0501:Stk11 UTSW 10 80126285 missense probably damaging 1.00
R3826:Stk11 UTSW 10 80127948 splice site probably null
R3827:Stk11 UTSW 10 80127948 splice site probably null
R3828:Stk11 UTSW 10 80127948 splice site probably null
R3829:Stk11 UTSW 10 80127948 splice site probably null
R4512:Stk11 UTSW 10 80126377 splice site probably benign
R4515:Stk11 UTSW 10 80116601 unclassified probably benign
R5123:Stk11 UTSW 10 80127941 missense probably damaging 1.00
R5188:Stk11 UTSW 10 80126279 missense probably damaging 1.00
R5341:Stk11 UTSW 10 80126260 missense probably benign 0.13
R5540:Stk11 UTSW 10 80126049 missense probably benign 0.00
R6856:Stk11 UTSW 10 80128090 missense probably benign 0.01
R7213:Stk11 UTSW 10 80116618 start codon destroyed probably null 0.05
R7792:Stk11 UTSW 10 80125437 intron probably benign
R8299:Stk11 UTSW 10 80128033 missense probably benign
Z1177:Stk11 UTSW 10 80128488 missense unknown
Predicted Primers PCR Primer
(F):5'- GTAAGGACAGCCATGGTGTG -3'
(R):5'- CCTTCATCTAGCCCAGAGTG -3'

Sequencing Primer
(F):5'- CTTTAGCTGGTTCCGGAAGAAACAC -3'
(R):5'- CTTCATCTAGCCCAGAGTGAAATG -3'
Posted On2017-02-03