Incidental Mutation 'IGL03055:Nefm'
ID453400
Institutional Source Beutler Lab
Gene Symbol Nefm
Ensembl Gene ENSMUSG00000022054
Gene Nameneurofilament, medium polypeptide
SynonymsNfm, NF160, NF-M, NF165, Nef3, neurofilament-M
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #IGL03055 (G1)
Quality Score132
Status Validated
Chromosome14
Chromosomal Location68082590-68124846 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68122909 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 371 (T371A)
Ref Sequence ENSEMBL: ENSMUSP00000106718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022638] [ENSMUST00000111089]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022638
AA Change: T371A

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022638
Gene: ENSMUSG00000022054
AA Change: T371A

DomainStartEndE-ValueType
Pfam:Filament_head 9 97 2.6e-18 PFAM
Filament 98 409 1.16e-131 SMART
coiled coil region 460 533 N/A INTRINSIC
low complexity region 540 604 N/A INTRINSIC
low complexity region 608 668 N/A INTRINSIC
low complexity region 703 719 N/A INTRINSIC
low complexity region 736 754 N/A INTRINSIC
low complexity region 777 796 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111089
AA Change: T371A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106718
Gene: ENSMUSG00000022054
AA Change: T371A

DomainStartEndE-ValueType
Pfam:Filament_head 9 97 1.6e-16 PFAM
Pfam:Filament 98 403 1.1e-104 PFAM
Meta Mutation Damage Score 0.3615 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced axon diameter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900041M22Rik T A 11: 117,612,246 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A430005L14Rik T A 4: 153,960,635 S40R probably benign Het
Aire A G 10: 78,043,069 L48P probably damaging Het
Alkbh8 T C 9: 3,345,882 probably benign Het
Aqp7 A G 4: 41,045,326 M18T probably benign Het
Cchcr1 T A 17: 35,526,619 M406K probably benign Het
Cdhr1 A T 14: 37,095,097 D102E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Clec16a T A 16: 10,741,781 S973T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd1 A G 8: 16,095,501 Y1471H probably damaging Het
Dnah12 A G 14: 26,872,740 Y3489C probably damaging Het
Ect2 T C 3: 27,137,062 E464G probably damaging Het
Enpp2 C A 15: 54,866,085 probably null Het
Erich2 G T 2: 70,509,185 C28F possibly damaging Het
Fam135b A T 15: 71,622,034 H15Q possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Gfral T A 9: 76,208,549 T48S probably benign Het
Itga10 A G 3: 96,650,520 E293G probably damaging Het
Lrp2 A T 2: 69,458,448 N3691K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nkain3 C A 4: 20,778,308 C3F probably benign Het
Nol4l G C 2: 153,436,270 silent Het
Nprl3 C A 11: 32,248,230 probably benign Het
Olfr656 A T 7: 104,618,206 I176F probably damaging Het
Pate2 T C 9: 35,611,773 probably benign Het
Pde4d A G 13: 109,935,345 K128R probably damaging Het
Ptprt A G 2: 161,533,613 L1329P probably damaging Het
Rapgef3 T C 15: 97,749,489 probably benign Het
Rassf5 T C 1: 131,244,995 I46V probably benign Het
Rin1 C T 19: 5,053,159 T481I probably benign Het
Samd4b A G 7: 28,405,546 L524P possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Srebf1 T C 11: 60,207,076 silent Het
Ssh2 C T 11: 77,408,195 Q123* probably null Het
St18 G T 1: 6,802,735 L231F probably damaging Het
Stk11 A C 10: 80,128,086 D96A probably damaging Het
Svil A G 18: 5,108,615 T1918A probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tlr1 C A 5: 64,926,596 V213F probably benign Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wnt6 G A 1: 74,782,854 R198H probably damaging Het
Yipf2 A T 9: 21,589,723 V98E probably benign Het
Zc3h15 A G 2: 83,661,171 T248A possibly damaging Het
Zc3hav1 C T 6: 38,316,316 probably null Het
Zfp697 T G 3: 98,425,494 C79G possibly damaging Het
Other mutations in Nefm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Nefm APN 14 68124464 missense probably damaging 1.00
IGL02379:Nefm APN 14 68120239 intron probably benign
IGL02664:Nefm APN 14 68120215 intron probably benign
IGL03115:Nefm APN 14 68120279 intron probably benign
IGL03328:Nefm APN 14 68121290 missense probably benign 0.28
P0025:Nefm UTSW 14 68120965 intron probably benign
R0055:Nefm UTSW 14 68121199 intron probably benign
R0055:Nefm UTSW 14 68121199 intron probably benign
R0111:Nefm UTSW 14 68124542 missense probably benign 0.43
R0240:Nefm UTSW 14 68121134 nonsense probably null
R0240:Nefm UTSW 14 68121134 nonsense probably null
R0480:Nefm UTSW 14 68124159 missense probably damaging 1.00
R0505:Nefm UTSW 14 68124159 missense probably damaging 1.00
R0565:Nefm UTSW 14 68124621 missense probably damaging 1.00
R1454:Nefm UTSW 14 68121379 missense probably damaging 1.00
R1902:Nefm UTSW 14 68124114 missense probably benign 0.02
R2680:Nefm UTSW 14 68123786 missense probably damaging 1.00
R3763:Nefm UTSW 14 68124348 missense probably damaging 1.00
R4996:Nefm UTSW 14 68121121 intron probably benign
R5426:Nefm UTSW 14 68120066 intron probably benign
R5613:Nefm UTSW 14 68121134 nonsense probably null
R5989:Nefm UTSW 14 68124329 missense probably benign 0.16
R7255:Nefm UTSW 14 68116000 missense probably benign 0.08
R8704:Nefm UTSW 14 68121061 missense unknown
R8775:Nefm UTSW 14 68124659 missense probably damaging 1.00
R8775-TAIL:Nefm UTSW 14 68124659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTTCGTAACTGAGCTGG -3'
(R):5'- ATAGCTAGGAGGGATGTCTGCG -3'

Sequencing Primer
(F):5'- CTCACTAGGCCAGCTTTGGTTTAAG -3'
(R):5'- ATGTCTGCGAGGCTCATG -3'
Posted On2017-02-03