Incidental Mutation 'IGL03055:Cchcr1'
ID453404
Institutional Source Beutler Lab
Gene Symbol Cchcr1
Ensembl Gene ENSMUSG00000040312
Gene Namecoiled-coil alpha-helical rod protein 1
SynonymsHcr
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #IGL03055 (G1)
Quality Score96
Status Validated
Chromosome17
Chromosomal Location35517100-35531015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35526619 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 406 (M406K)
Ref Sequence ENSEMBL: ENSMUSP00000132028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045956] [ENSMUST00000164242] [ENSMUST00000173903]
Predicted Effect probably benign
Transcript: ENSMUST00000045956
AA Change: M406K

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046612
Gene: ENSMUSG00000040312
AA Change: M406K

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164242
AA Change: M406K

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132028
Gene: ENSMUSG00000040312
AA Change: M406K

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173582
Predicted Effect probably benign
Transcript: ENSMUST00000173903
AA Change: M489K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133407
Gene: ENSMUSG00000040312
AA Change: M489K

DomainStartEndE-ValueType
Pfam:HCR 110 855 N/A PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900041M22Rik T A 11: 117,612,246 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A430005L14Rik T A 4: 153,960,635 S40R probably benign Het
Aire A G 10: 78,043,069 L48P probably damaging Het
Alkbh8 T C 9: 3,345,882 probably benign Het
Aqp7 A G 4: 41,045,326 M18T probably benign Het
Cdhr1 A T 14: 37,095,097 D102E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Clec16a T A 16: 10,741,781 S973T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd1 A G 8: 16,095,501 Y1471H probably damaging Het
Dnah12 A G 14: 26,872,740 Y3489C probably damaging Het
Ect2 T C 3: 27,137,062 E464G probably damaging Het
Enpp2 C A 15: 54,866,085 probably null Het
Erich2 G T 2: 70,509,185 C28F possibly damaging Het
Fam135b A T 15: 71,622,034 H15Q possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Gfral T A 9: 76,208,549 T48S probably benign Het
Itga10 A G 3: 96,650,520 E293G probably damaging Het
Lrp2 A T 2: 69,458,448 N3691K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nefm T C 14: 68,122,909 T371A probably damaging Het
Nkain3 C A 4: 20,778,308 C3F probably benign Het
Nol4l G C 2: 153,436,270 silent Het
Nprl3 C A 11: 32,248,230 probably benign Het
Olfr656 A T 7: 104,618,206 I176F probably damaging Het
Pate2 T C 9: 35,611,773 probably benign Het
Pde4d A G 13: 109,935,345 K128R probably damaging Het
Ptprt A G 2: 161,533,613 L1329P probably damaging Het
Rapgef3 T C 15: 97,749,489 probably benign Het
Rassf5 T C 1: 131,244,995 I46V probably benign Het
Rin1 C T 19: 5,053,159 T481I probably benign Het
Samd4b A G 7: 28,405,546 L524P possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Srebf1 T C 11: 60,207,076 silent Het
Ssh2 C T 11: 77,408,195 Q123* probably null Het
St18 G T 1: 6,802,735 L231F probably damaging Het
Stk11 A C 10: 80,128,086 D96A probably damaging Het
Svil A G 18: 5,108,615 T1918A probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tlr1 C A 5: 64,926,596 V213F probably benign Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wnt6 G A 1: 74,782,854 R198H probably damaging Het
Yipf2 A T 9: 21,589,723 V98E probably benign Het
Zc3h15 A G 2: 83,661,171 T248A possibly damaging Het
Zc3hav1 C T 6: 38,316,316 probably null Het
Zfp697 T G 3: 98,425,494 C79G possibly damaging Het
Other mutations in Cchcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Cchcr1 APN 17 35528572 missense possibly damaging 0.92
IGL02723:Cchcr1 APN 17 35530802 missense probably benign 0.00
IGL02806:Cchcr1 APN 17 35525256 splice site probably benign
R0569:Cchcr1 UTSW 17 35528968 critical splice donor site probably null
R1438:Cchcr1 UTSW 17 35530560 critical splice donor site probably null
R2055:Cchcr1 UTSW 17 35526420 missense probably damaging 1.00
R2511:Cchcr1 UTSW 17 35530513 missense probably benign 0.01
R3910:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3911:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3913:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R5590:Cchcr1 UTSW 17 35526680 missense probably damaging 1.00
R5821:Cchcr1 UTSW 17 35528848 missense probably damaging 1.00
R5940:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R5941:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R6006:Cchcr1 UTSW 17 35524700 missense possibly damaging 0.83
R6114:Cchcr1 UTSW 17 35525330 missense probably damaging 0.98
R6146:Cchcr1 UTSW 17 35528578 missense possibly damaging 0.92
R6262:Cchcr1 UTSW 17 35530516 missense probably benign 0.04
R6369:Cchcr1 UTSW 17 35528176 missense probably damaging 0.99
R6478:Cchcr1 UTSW 17 35524703 missense possibly damaging 0.71
R6827:Cchcr1 UTSW 17 35530405 missense possibly damaging 0.71
R6860:Cchcr1 UTSW 17 35529118 missense possibly damaging 0.85
R7109:Cchcr1 UTSW 17 35517941 critical splice donor site probably null
R7276:Cchcr1 UTSW 17 35529134 missense possibly damaging 0.46
R7341:Cchcr1 UTSW 17 35526713 missense probably benign 0.00
R7404:Cchcr1 UTSW 17 35524796 missense probably benign 0.09
R7472:Cchcr1 UTSW 17 35528351 missense probably damaging 1.00
R7666:Cchcr1 UTSW 17 35526486 missense probably benign 0.01
X0025:Cchcr1 UTSW 17 35526676 missense probably benign 0.13
Z1177:Cchcr1 UTSW 17 35528663 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCAAGTGACCTCCCAAAG -3'
(R):5'- GGTGTGATACAGAGGTGACACC -3'

Sequencing Primer
(F):5'- AGCAGGCCATCTTGCAG -3'
(R):5'- GATACAGAGGTGACACCCCTCC -3'
Posted On2017-02-03