Incidental Mutation 'R5141:Slc17a5'
ID453410
Institutional Source Beutler Lab
Gene Symbol Slc17a5
Ensembl Gene ENSMUSG00000049624
Gene Namesolute carrier family 17 (anion/sugar transporter), member 5
Synonyms4631416G20Rik
MMRRC Submission 042727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5141 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location78536488-78588041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78540988 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 395 (Y395H)
Ref Sequence ENSEMBL: ENSMUSP00000113003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052441] [ENSMUST00000117645]
Predicted Effect probably damaging
Transcript: ENSMUST00000052441
AA Change: Y421H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056182
Gene: ENSMUSG00000049624
AA Change: Y421H

DomainStartEndE-ValueType
Pfam:MFS_1 46 441 1.8e-61 PFAM
transmembrane domain 456 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117645
AA Change: Y395H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113003
Gene: ENSMUSG00000049624
AA Change: Y395H

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
Pfam:MFS_1 97 415 2.5e-50 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Meta Mutation Damage Score 0.2289 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane transporter that exports free sialic acids that have been cleaved off of cell surface lipids and proteins from lysosomes. Mutations in this gene cause sialic acid storage diseases, including infantile sialic acid storage disorder and and Salla disease, an adult form. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit numerous neurological abnormalities, including impaired exploratory and locomotor activity, hearing deficits, and an increased depressive-like response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,573,128 V193A probably benign Het
Adamts18 T A 8: 113,775,270 T320S probably damaging Het
Adamtsl1 G T 4: 86,156,850 M151I possibly damaging Het
Adgrv1 A T 13: 81,270,918 V5986E probably damaging Het
Aifm3 A G 16: 17,499,722 E69G probably damaging Het
Akap13 C A 7: 75,609,614 T662K probably benign Het
Alms1 A G 6: 85,621,432 D1080G probably benign Het
Als2 T C 1: 59,170,452 E1457G possibly damaging Het
Apobec4 A G 1: 152,756,213 probably benign Het
Apoo-ps C T 13: 107,414,395 noncoding transcript Het
Aspscr1 G A 11: 120,689,177 V181I probably benign Het
Atrn T C 2: 130,999,130 probably benign Het
C3 T A 17: 57,219,570 I804F probably damaging Het
Cbfa2t3 C T 8: 122,635,021 G421R probably benign Het
Chmp4c A G 3: 10,367,153 E41G probably damaging Het
Clk4 T A 11: 51,275,771 F96L possibly damaging Het
Ctsg G A 14: 56,101,727 R25* probably null Het
Cul1 A G 6: 47,520,839 D618G probably benign Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dip2a G A 10: 76,270,453 T1326I probably damaging Het
Etnk2 A G 1: 133,368,862 I210V probably benign Het
Gm5773 T A 3: 93,773,727 D235E probably benign Het
Gm7353 T C 7: 3,111,001 noncoding transcript Het
Gpi1 G A 7: 34,227,096 probably benign Het
Ing4 T C 6: 125,039,874 M5T probably benign Het
Inpp4a A G 1: 37,380,087 I583V probably benign Het
Isyna1 T C 8: 70,594,893 V64A probably damaging Het
Katnal2 T A 18: 76,997,641 D310V probably damaging Het
Kbtbd8 A G 6: 95,121,839 T126A probably damaging Het
Kif13a T C 13: 46,752,721 D582G probably benign Het
Lmf2 G A 15: 89,351,607 probably null Het
Lrp2 T C 2: 69,552,349 probably null Het
Lrp4 T C 2: 91,478,678 probably benign Het
Lyzl1 A C 18: 4,169,209 D71A possibly damaging Het
Mak C T 13: 41,032,563 C543Y possibly damaging Het
Mapk8ip1 T C 2: 92,386,765 D404G probably damaging Het
Mdga1 C T 17: 29,852,493 E385K probably benign Het
Mst1r T A 9: 107,912,241 I573N probably damaging Het
Muc5ac T A 7: 141,814,742 N2365K possibly damaging Het
Ncan T C 8: 70,112,837 E179G probably damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1228 A C 2: 89,249,129 Y176* probably null Het
Olfr44 A G 9: 39,484,531 F238L probably damaging Het
Olfr975 T G 9: 39,949,874 K299T probably benign Het
Pcolce G T 5: 137,605,750 Q352K probably benign Het
Peg3 G T 7: 6,709,382 T947N probably benign Het
Pld3 C T 7: 27,533,795 D344N probably damaging Het
Plec A C 15: 76,190,533 D411E probably damaging Het
Pmp2 C T 3: 10,182,414 D72N probably benign Het
Ptpn9 T C 9: 57,036,676 V278A possibly damaging Het
Rbm33 A G 5: 28,352,689 H300R probably damaging Het
Rpgrip1l T C 8: 91,260,918 Q837R probably benign Het
Rwdd4a T C 8: 47,550,674 probably benign Het
Sema6a T C 18: 47,248,388 T1048A probably damaging Het
Senp1 G A 15: 98,076,607 A108V probably benign Het
Serpine2 G T 1: 79,802,863 Q290K possibly damaging Het
Sesn1 A G 10: 41,811,101 N27S probably benign Het
Shroom1 T A 11: 53,463,982 L243* probably null Het
Slc5a8 T C 10: 88,919,560 probably null Het
Sptbn5 G A 2: 120,061,731 S1083F probably benign Het
Stx4a T A 7: 127,846,615 V231E probably damaging Het
Swt1 A T 1: 151,411,394 S116T probably benign Het
Syt9 C T 7: 107,504,219 T408I probably damaging Het
Tgm7 T C 2: 121,100,999 T228A probably benign Het
Tmem115 A G 9: 107,537,942 D310G probably benign Het
Trcg1 G A 9: 57,241,304 G53D probably damaging Het
Tsfm T C 10: 127,029,613 K100E probably damaging Het
Usp1 A G 4: 98,934,209 T587A probably damaging Het
Vcpip1 G T 1: 9,748,077 A27E unknown Het
Vmn2r49 T C 7: 9,986,373 N397S probably benign Het
Vmn2r8 A G 5: 108,808,706 S17P probably damaging Het
Vwa3b A G 1: 37,187,021 probably benign Het
Ythdc2 T A 18: 44,865,047 S1094T probably benign Het
Zbtb22 C G 17: 33,918,636 S585C possibly damaging Het
Zhx2 A G 15: 57,821,786 T184A probably benign Het
Other mutations in Slc17a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Slc17a5 APN 9 78578534 missense probably benign
IGL00828:Slc17a5 APN 9 78578551 missense probably benign 0.37
IGL01603:Slc17a5 APN 9 78574707 missense probably damaging 1.00
IGL01945:Slc17a5 APN 9 78587932 missense probably benign 0.01
IGL03250:Slc17a5 APN 9 78578564 missense probably damaging 0.99
PIT4618001:Slc17a5 UTSW 9 78538248 missense possibly damaging 0.52
R0136:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0245:Slc17a5 UTSW 9 78540924 missense probably benign 0.00
R0305:Slc17a5 UTSW 9 78557537 missense probably benign 0.25
R0481:Slc17a5 UTSW 9 78538302 splice site probably null
R0657:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0763:Slc17a5 UTSW 9 78553090 splice site probably benign
R1543:Slc17a5 UTSW 9 78560800 missense probably benign 0.01
R1564:Slc17a5 UTSW 9 78578699 missense probably damaging 0.98
R2155:Slc17a5 UTSW 9 78577173 missense probably damaging 1.00
R2483:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R3623:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R4193:Slc17a5 UTSW 9 78559106 missense possibly damaging 0.58
R4794:Slc17a5 UTSW 9 78574715 missense probably damaging 0.96
R5115:Slc17a5 UTSW 9 78577112 missense probably benign 0.12
R5205:Slc17a5 UTSW 9 78578617 missense probably damaging 1.00
R5953:Slc17a5 UTSW 9 78557498 missense probably damaging 1.00
R6481:Slc17a5 UTSW 9 78538271 missense possibly damaging 0.87
R7375:Slc17a5 UTSW 9 78587892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCACAAAGAATTTCATAAAAGCCA -3'
(R):5'- ATTTCTTTGCTCAGGAATAGGTACC -3'

Sequencing Primer
(F):5'- GTTCCAGGACCTAGATAATGGCC -3'
(R):5'- GGAATAGGTACCCCCTGGACTTTATC -3'
Posted On2017-02-03