Incidental Mutation 'R5046:Car12'
ID453413
Institutional Source Beutler Lab
Gene Symbol Car12
Ensembl Gene ENSMUSG00000032373
Gene Namecarbonic anhydrase 12
Synonyms2310047E01Rik, CA XII
MMRRC Submission 042636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5046 (G1)
Quality Score57
Status Validated
Chromosome9
Chromosomal Location66713686-66766845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66746613 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 84 (E84K)
Ref Sequence ENSEMBL: ENSMUSP00000082541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071889] [ENSMUST00000085420] [ENSMUST00000134829]
Predicted Effect probably benign
Transcript: ENSMUST00000071889
AA Change: E84K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071786
Gene: ENSMUSG00000032373
AA Change: E84K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Carb_anhydrase 32 290 8.86e-126 SMART
transmembrane domain 305 327 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085420
AA Change: E84K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082541
Gene: ENSMUSG00000032373
AA Change: E84K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Carb_anhydrase 32 290 8.86e-126 SMART
transmembrane domain 295 317 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123195
Predicted Effect probably benign
Transcript: ENSMUST00000134829
SMART Domains Protein: ENSMUSP00000118030
Gene: ENSMUSG00000032373

DomainStartEndE-ValueType
Carb_anhydrase 1 153 3.06e-15 SMART
transmembrane domain 168 190 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152011
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a membrane-bound member of the alpha carbonic anhydrase family of enzymes that catalyze the reversible hydration of carbon dioxide to bicarbonate. These proteins participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transposon-induced mutation that inactivates this gene display reduced fitness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Wdr73 A T 7: 80,892,425 probably benign Het
Other mutations in Car12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Car12 APN 9 66763270 missense possibly damaging 0.73
IGL02280:Car12 APN 9 66746575 missense probably damaging 1.00
IGL02347:Car12 APN 9 66764347 missense possibly damaging 0.62
IGL02582:Car12 APN 9 66713877 missense probably benign
IGL02612:Car12 APN 9 66762424 missense probably damaging 0.97
IGL02645:Car12 APN 9 66747679 missense probably benign 0.42
LCD18:Car12 UTSW 9 66761676 intron probably benign
R2033:Car12 UTSW 9 66717558 critical splice acceptor site probably null
R2118:Car12 UTSW 9 66713892 missense probably benign 0.05
R2263:Car12 UTSW 9 66747631 nonsense probably null
R3111:Car12 UTSW 9 66753726 missense probably damaging 1.00
R3710:Car12 UTSW 9 66750978 missense probably damaging 1.00
R3872:Car12 UTSW 9 66717552 splice site probably benign
R3875:Car12 UTSW 9 66717552 splice site probably benign
R4898:Car12 UTSW 9 66764318 nonsense probably null
R6238:Car12 UTSW 9 66753726 missense probably damaging 1.00
R6788:Car12 UTSW 9 66751962 missense probably damaging 0.98
R7105:Car12 UTSW 9 66752406 missense probably damaging 1.00
R7231:Car12 UTSW 9 66752317 missense probably damaging 0.99
R7380:Car12 UTSW 9 66747663 missense probably benign 0.03
R8302:Car12 UTSW 9 66747597 missense probably benign
X0019:Car12 UTSW 9 66751957 missense probably damaging 1.00
Z1177:Car12 UTSW 9 66751954 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTGTGGAAAACTGAGCTTGAGTC -3'
(R):5'- GTTTTGAGATGTGCTACCCAC -3'

Sequencing Primer
(F):5'- GGAAAACTGAGCTTGAGTCTCTCC -3'
(R):5'- AATCACTGGAGCCAGGGC -3'
Posted On2017-02-03