Incidental Mutation 'IGL03050:G530012D18Rik'
ID453416
Institutional Source Beutler Lab
Gene Symbol G530012D18Rik
Ensembl Gene ENSMUSG00000094127
Gene NameRIKEN cDNA G530012D1 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #IGL03050 (G1)
Quality Score109
Status Validated
Chromosome1
Chromosomal Location85575676-85577295 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGAGAGA to CAGAGAGAGA at 85577224 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect probably null
Transcript: ENSMUST00000178024
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,381 V825E probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Ankrd2 G A 19: 42,040,094 R63H probably damaging Het
Bbs2 C A 8: 94,074,413 probably benign Het
Btbd7 G T 12: 102,812,806 D400E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col17a1 C T 19: 47,648,098 probably null Het
Col3a1 A G 1: 45,328,925 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dpp8 C G 9: 65,054,836 S386C probably benign Het
Dscaml1 A C 9: 45,742,999 D1443A probably damaging Het
Dsp T C 13: 38,188,445 probably benign Het
Elf2 C T 3: 51,257,617 R262Q probably benign Het
Fat3 G A 9: 15,996,600 S2702F probably benign Het
Gabrb1 T A 5: 72,122,154 S347R probably benign Het
Hivep1 T C 13: 42,156,128 S615P probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mirt1 A G 19: 53,445,279 noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mug1 T A 6: 121,880,571 S1085T possibly damaging Het
Myo18a A T 11: 77,818,770 T190S probably benign Het
Myo5a G A 9: 75,146,909 probably null Het
Olfr1012 A G 2: 85,759,441 *312Q probably null Het
Olfr1434 G T 19: 12,283,512 V155L probably benign Het
Olfr24 A T 9: 18,755,454 Y60* probably null Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr356 T A 2: 36,937,623 F168Y probably damaging Het
Rgma G A 7: 73,417,515 V173M probably damaging Het
Rgsl1 G A 1: 153,825,676 S379F possibly damaging Het
Sec16a T A 2: 26,415,747 D2215V probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thrap3 G A 4: 126,165,542 probably null Het
Ttyh2 T A 11: 114,708,854 L370Q probably damaging Het
Ugt8a T C 3: 125,875,490 R322G possibly damaging Het
Vmn2r97 T C 17: 18,947,638 M718T possibly damaging Het
Zhx2 T C 15: 57,822,833 F533L possibly damaging Het
Other mutations in G530012D18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:G530012D18Rik UTSW 1 85577152 small deletion probably benign
FR4449:G530012D18Rik UTSW 1 85577180 small deletion probably benign
FR4737:G530012D18Rik UTSW 1 85577178 frame shift probably null
PIT4142001:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R0707:G530012D18Rik UTSW 1 85577224 frame shift probably null
R0730:G530012D18Rik UTSW 1 85577036 utr 3 prime probably benign
R0819:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1053:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1155:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1236:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1245:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1880:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1961:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2033:G530012D18Rik UTSW 1 85577154 frame shift probably null
R2055:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2510:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R2903:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2989:G530012D18Rik UTSW 1 85577216 frame shift probably null
R3000:G530012D18Rik UTSW 1 85577224 frame shift probably null
R3757:G530012D18Rik UTSW 1 85577224 frame shift probably null
R3914:G530012D18Rik UTSW 1 85577224 frame shift probably null
R4358:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4407:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4417:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R5086:G530012D18Rik UTSW 1 85577220 utr 3 prime probably benign
R5389:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R7212:G530012D18Rik UTSW 1 85577143 missense unknown
X0023:G530012D18Rik UTSW 1 85577224 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCGTGAGCGTGTACCACAG -3'
(R):5'- ACAGGTGTTTCCTAAAGGGG -3'

Sequencing Primer
(F):5'- TGTACCACAGTGCTGGGTCAG -3'
(R):5'- GGGGGAAACATCAATATTCACAAG -3'
Posted On2017-02-08