Incidental Mutation 'IGL03050:Gabrb1'
ID 453429
Institutional Source Beutler Lab
Gene Symbol Gabrb1
Ensembl Gene ENSMUSG00000029212
Gene Name gamma-aminobutyric acid type A receptor subunit beta 1
Synonyms Gabrb-1, B230208N19Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03050 (G1)
Quality Score 204
Status Validated
Chromosome 5
Chromosomal Location 71815456-72306380 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 72279497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 347 (S347R)
Ref Sequence ENSEMBL: ENSMUSP00000031122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031122]
AlphaFold P50571
Predicted Effect probably benign
Transcript: ENSMUST00000031122
AA Change: S347R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: S347R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 7.1e-52 PFAM
Pfam:Neur_chan_memb 250 469 2.4e-48 PFAM
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Ankrd2 G A 19: 42,028,533 (GRCm39) R63H probably damaging Het
Bbs2 C A 8: 94,801,041 (GRCm39) probably benign Het
Btbd7 G T 12: 102,779,065 (GRCm39) D400E probably benign Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Col17a1 C T 19: 47,636,537 (GRCm39) probably null Het
Col3a1 A G 1: 45,368,085 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Dpp8 C G 9: 64,962,118 (GRCm39) S386C probably benign Het
Dscaml1 A C 9: 45,654,297 (GRCm39) D1443A probably damaging Het
Dsp T C 13: 38,372,421 (GRCm39) probably benign Het
Elf2 C T 3: 51,165,038 (GRCm39) R262Q probably benign Het
Fat3 G A 9: 15,907,896 (GRCm39) S2702F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Hivep1 T C 13: 42,309,604 (GRCm39) S615P probably benign Het
Kcnq3 T C 15: 65,897,027 (GRCm39) D291G possibly damaging Het
Lyl1 C T 8: 85,429,300 (GRCm39) P3L possibly damaging Het
Mirt1 A G 19: 53,433,710 (GRCm39) noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mug1 T A 6: 121,857,530 (GRCm39) S1085T possibly damaging Het
Myo18a A T 11: 77,709,596 (GRCm39) T190S probably benign Het
Myo5a G A 9: 75,054,191 (GRCm39) probably null Het
Or1ak2 T A 2: 36,827,635 (GRCm39) F168Y probably damaging Het
Or1l8 A T 2: 36,817,820 (GRCm39) M102K probably damaging Het
Or1m1 A T 9: 18,666,750 (GRCm39) Y60* probably null Het
Or5an1 G T 19: 12,260,876 (GRCm39) V155L probably benign Het
Or9g3 A G 2: 85,589,785 (GRCm39) *312Q probably null Het
Relch T A 1: 105,654,106 (GRCm39) V825E probably damaging Het
Rgma G A 7: 73,067,263 (GRCm39) V173M probably damaging Het
Rgsl1 G A 1: 153,701,422 (GRCm39) S379F possibly damaging Het
Sec16a T A 2: 26,305,759 (GRCm39) D2215V probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Thrap3 G A 4: 126,059,335 (GRCm39) probably null Het
Ttyh2 T A 11: 114,599,680 (GRCm39) L370Q probably damaging Het
Ugt8a T C 3: 125,669,139 (GRCm39) R322G possibly damaging Het
Vmn2r97 T C 17: 19,167,900 (GRCm39) M718T possibly damaging Het
Zhx2 T C 15: 57,686,229 (GRCm39) F533L possibly damaging Het
Other mutations in Gabrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Gabrb1 APN 5 72,265,789 (GRCm39) critical splice donor site probably null
IGL00774:Gabrb1 APN 5 72,265,789 (GRCm39) critical splice donor site probably null
IGL01534:Gabrb1 APN 5 72,026,772 (GRCm39) missense possibly damaging 0.95
IGL02170:Gabrb1 APN 5 72,294,073 (GRCm39) missense probably damaging 1.00
IGL02326:Gabrb1 APN 5 71,858,190 (GRCm39) missense probably damaging 0.99
IGL03278:Gabrb1 APN 5 72,026,939 (GRCm39) missense probably damaging 1.00
IGL03345:Gabrb1 APN 5 72,293,908 (GRCm39) missense possibly damaging 0.53
PIT4445001:Gabrb1 UTSW 5 72,266,125 (GRCm39) missense probably damaging 1.00
PIT4515001:Gabrb1 UTSW 5 71,858,160 (GRCm39) missense probably damaging 1.00
R0109:Gabrb1 UTSW 5 72,279,289 (GRCm39) splice site probably benign
R0386:Gabrb1 UTSW 5 72,266,150 (GRCm39) missense probably damaging 0.99
R1512:Gabrb1 UTSW 5 72,266,048 (GRCm39) missense probably damaging 1.00
R1512:Gabrb1 UTSW 5 72,266,047 (GRCm39) missense probably damaging 1.00
R1717:Gabrb1 UTSW 5 72,265,694 (GRCm39) splice site probably null
R1832:Gabrb1 UTSW 5 72,279,281 (GRCm39) splice site probably null
R1961:Gabrb1 UTSW 5 71,857,679 (GRCm39) missense probably benign 0.28
R2363:Gabrb1 UTSW 5 72,026,916 (GRCm39) nonsense probably null
R4686:Gabrb1 UTSW 5 71,857,365 (GRCm39) missense possibly damaging 0.53
R4840:Gabrb1 UTSW 5 71,858,154 (GRCm39) missense probably damaging 1.00
R4916:Gabrb1 UTSW 5 72,026,764 (GRCm39) missense probably damaging 1.00
R4941:Gabrb1 UTSW 5 72,294,121 (GRCm39) missense probably damaging 1.00
R5250:Gabrb1 UTSW 5 72,026,922 (GRCm39) missense possibly damaging 0.80
R5270:Gabrb1 UTSW 5 72,265,669 (GRCm39) missense probably damaging 1.00
R5364:Gabrb1 UTSW 5 72,294,105 (GRCm39) missense probably benign 0.33
R5407:Gabrb1 UTSW 5 72,279,364 (GRCm39) missense possibly damaging 0.90
R5621:Gabrb1 UTSW 5 72,266,071 (GRCm39) missense probably damaging 1.00
R5790:Gabrb1 UTSW 5 72,293,827 (GRCm39) missense possibly damaging 0.53
R6236:Gabrb1 UTSW 5 72,265,663 (GRCm39) missense probably damaging 1.00
R6336:Gabrb1 UTSW 5 72,187,241 (GRCm39) missense possibly damaging 0.72
R7411:Gabrb1 UTSW 5 72,279,538 (GRCm39) critical splice donor site probably null
R8375:Gabrb1 UTSW 5 72,187,172 (GRCm39) missense probably damaging 0.98
R9161:Gabrb1 UTSW 5 72,187,199 (GRCm39) missense probably damaging 0.98
R9474:Gabrb1 UTSW 5 72,265,690 (GRCm39) missense probably damaging 1.00
R9621:Gabrb1 UTSW 5 72,279,363 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTCTTGGCTTTGGAAAACACAGC -3'
(R):5'- TTCTCAGATCTATAAACTGAGGCC -3'

Sequencing Primer
(F):5'- GAATCACTACGGTGCTGACCATG -3'
(R):5'- TAGGGACGGGATTAGCAAT -3'
Posted On 2017-02-08