Incidental Mutation 'IGL03050:Olfr1434'
ID 453449
Institutional Source Beutler Lab
Gene Symbol Olfr1434
Ensembl Gene ENSMUSG00000095640
Gene Name olfactory receptor 1434
Synonyms MOR214-4, Olfr1433, MOR214-4, GA_x6K02T2RE5P-2618516-2619454, GA_x6K02T2RE5P-2610001-2610414
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # IGL03050 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12279854-12285626 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 12283512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 155 (V155L)
Ref Sequence ENSEMBL: ENSMUSP00000146411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000207186] [ENSMUST00000207915] [ENSMUST00000208197]
AlphaFold Q7TQR9
Predicted Effect probably benign
Transcript: ENSMUST00000087814
AA Change: V155L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085115
Gene: ENSMUSG00000095640
AA Change: V155L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 9.2e-55 PFAM
Pfam:7tm_1 42 307 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207186
AA Change: V155L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207915
Predicted Effect probably benign
Transcript: ENSMUST00000208197
AA Change: V155L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,381 V825E probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Ankrd2 G A 19: 42,040,094 R63H probably damaging Het
Bbs2 C A 8: 94,074,413 probably benign Het
Btbd7 G T 12: 102,812,806 D400E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col17a1 C T 19: 47,648,098 probably null Het
Col3a1 A G 1: 45,328,925 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dpp8 C G 9: 65,054,836 S386C probably benign Het
Dscaml1 A C 9: 45,742,999 D1443A probably damaging Het
Dsp T C 13: 38,188,445 probably benign Het
Elf2 C T 3: 51,257,617 R262Q probably benign Het
Fat3 G A 9: 15,996,600 S2702F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 T A 5: 72,122,154 S347R probably benign Het
Hivep1 T C 13: 42,156,128 S615P probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mirt1 A G 19: 53,445,279 noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mug1 T A 6: 121,880,571 S1085T possibly damaging Het
Myo18a A T 11: 77,818,770 T190S probably benign Het
Myo5a G A 9: 75,146,909 probably null Het
Olfr1012 A G 2: 85,759,441 *312Q probably null Het
Olfr24 A T 9: 18,755,454 Y60* probably null Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr356 T A 2: 36,937,623 F168Y probably damaging Het
Rgma G A 7: 73,417,515 V173M probably damaging Het
Rgsl1 G A 1: 153,825,676 S379F possibly damaging Het
Sec16a T A 2: 26,415,747 D2215V probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thrap3 G A 4: 126,165,542 probably null Het
Ttyh2 T A 11: 114,708,854 L370Q probably damaging Het
Ugt8a T C 3: 125,875,490 R322G possibly damaging Het
Vmn2r97 T C 17: 18,947,638 M718T possibly damaging Het
Zhx2 T C 15: 57,822,833 F533L possibly damaging Het
Other mutations in Olfr1434
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Olfr1434 APN 19 12283705 missense probably damaging 1.00
IGL02415:Olfr1434 APN 19 12283498 missense probably benign 0.44
IGL02731:Olfr1434 APN 19 12283842 missense probably damaging 0.99
IGL02803:Olfr1434 APN 19 12283983 missense possibly damaging 0.94
R0432:Olfr1434 UTSW 19 12283903 missense probably damaging 1.00
R2209:Olfr1434 UTSW 19 12283860 missense probably benign 0.41
R3710:Olfr1434 UTSW 19 12283086 missense probably damaging 1.00
R4724:Olfr1434 UTSW 19 12283096 missense probably damaging 1.00
R5133:Olfr1434 UTSW 19 12283306 missense possibly damaging 0.96
R5974:Olfr1434 UTSW 19 12283836 missense probably damaging 1.00
R6544:Olfr1434 UTSW 19 12283155 missense probably damaging 1.00
R7225:Olfr1434 UTSW 19 12283467 missense probably benign 0.00
R7320:Olfr1434 UTSW 19 12283816 missense possibly damaging 0.72
R7467:Olfr1434 UTSW 19 12283475 nonsense probably null
R7900:Olfr1434 UTSW 19 12283341 missense probably damaging 1.00
R8719:Olfr1434 UTSW 19 12283428 missense probably benign 0.13
R9135:Olfr1434 UTSW 19 12283444 missense probably damaging 1.00
R9324:Olfr1434 UTSW 19 12283575 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCAAACTATCAGCTTTGTGGGC -3'
(R):5'- GGCGATATACCCATAGGACAC -3'

Sequencing Primer
(F):5'- GTGGGCTGCATAGTTCAATAC -3'
(R):5'- ATGGCTAAGGCGTTTATAAGCCC -3'
Posted On 2017-02-08