Incidental Mutation 'IGL03050:Ankrd2'
ID453450
Institutional Source Beutler Lab
Gene Symbol Ankrd2
Ensembl Gene ENSMUSG00000025172
Gene Nameankyrin repeat domain 2 (stretch responsive muscle)
SynonymsmArpp, Arpp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03050 (G1)
Quality Score174
Status Validated
Chromosome19
Chromosomal Location42036038-42045110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42040094 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 63 (R63H)
Ref Sequence ENSEMBL: ENSMUSP00000026172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026172]
Predicted Effect probably damaging
Transcript: ENSMUST00000026172
AA Change: R63H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026172
Gene: ENSMUSG00000025172
AA Change: R63H

DomainStartEndE-ValueType
low complexity region 104 111 N/A INTRINSIC
ANK 149 178 5.24e-4 SMART
ANK 182 211 5.79e-6 SMART
ANK 215 244 1.33e-5 SMART
ANK 248 277 3.18e-3 SMART
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the muscle ankyrin repeat protein (MARP) family. A similar gene in rodents is a component of a muscle stress response pathway and plays a role in the stretch-response associated with slow muscle function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and free of cardiac defects but exhibit altered inflammatory responses and are prone to skeletal muscle fiber-type switching of slow fibers toward a faster phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,381 V825E probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Bbs2 C A 8: 94,074,413 probably benign Het
Btbd7 G T 12: 102,812,806 D400E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col17a1 C T 19: 47,648,098 probably null Het
Col3a1 A G 1: 45,328,925 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dpp8 C G 9: 65,054,836 S386C probably benign Het
Dscaml1 A C 9: 45,742,999 D1443A probably damaging Het
Dsp T C 13: 38,188,445 probably benign Het
Elf2 C T 3: 51,257,617 R262Q probably benign Het
Fat3 G A 9: 15,996,600 S2702F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 T A 5: 72,122,154 S347R probably benign Het
Hivep1 T C 13: 42,156,128 S615P probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mirt1 A G 19: 53,445,279 noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mug1 T A 6: 121,880,571 S1085T possibly damaging Het
Myo18a A T 11: 77,818,770 T190S probably benign Het
Myo5a G A 9: 75,146,909 probably null Het
Olfr1012 A G 2: 85,759,441 *312Q probably null Het
Olfr1434 G T 19: 12,283,512 V155L probably benign Het
Olfr24 A T 9: 18,755,454 Y60* probably null Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr356 T A 2: 36,937,623 F168Y probably damaging Het
Rgma G A 7: 73,417,515 V173M probably damaging Het
Rgsl1 G A 1: 153,825,676 S379F possibly damaging Het
Sec16a T A 2: 26,415,747 D2215V probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thrap3 G A 4: 126,165,542 probably null Het
Ttyh2 T A 11: 114,708,854 L370Q probably damaging Het
Ugt8a T C 3: 125,875,490 R322G possibly damaging Het
Vmn2r97 T C 17: 18,947,638 M718T possibly damaging Het
Zhx2 T C 15: 57,822,833 F533L possibly damaging Het
Other mutations in Ankrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Ankrd2 APN 19 42039910 missense probably damaging 0.97
IGL03088:Ankrd2 APN 19 42041985 missense probably null 0.01
R0133:Ankrd2 UTSW 19 42044071 missense probably benign 0.01
R0930:Ankrd2 UTSW 19 42043853 critical splice donor site probably null
R2135:Ankrd2 UTSW 19 42044059 missense probably damaging 1.00
R2204:Ankrd2 UTSW 19 42044119 missense probably damaging 0.98
R2205:Ankrd2 UTSW 19 42044119 missense probably damaging 0.98
R4529:Ankrd2 UTSW 19 42043801 missense probably benign 0.05
R4833:Ankrd2 UTSW 19 42043857 splice site probably null
R5112:Ankrd2 UTSW 19 42039887 missense possibly damaging 0.71
R6005:Ankrd2 UTSW 19 42040115 missense probably damaging 1.00
R6146:Ankrd2 UTSW 19 42040105 missense possibly damaging 0.57
R7382:Ankrd2 UTSW 19 42044972 missense
R7556:Ankrd2 UTSW 19 42040400 missense
X0063:Ankrd2 UTSW 19 42042403 missense probably benign 0.01
Z1177:Ankrd2 UTSW 19 42040159 missense
Z1177:Ankrd2 UTSW 19 42044999 missense
Predicted Primers PCR Primer
(F):5'- ACTTCGAAGATCCGCTCCTG -3'
(R):5'- TGTCTAAATCAGGAGCCTTACG -3'

Sequencing Primer
(F):5'- CCATGGACATGCTAGTGCTAG -3'
(R):5'- GTCTAAATCAGGAGCCTTACGATCTC -3'
Posted On2017-02-08