Incidental Mutation 'IGL02988:Kif5c'
ID453466
Institutional Source Beutler Lab
Gene Symbol Kif5c
Ensembl Gene ENSMUSG00000026764
Gene Namekinesin family member 5C
SynonymsKhc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02988 (G1)
Quality Score153
Status Validated
Chromosome2
Chromosomal Location49619298-49774778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49619717 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 19 (N19S)
Ref Sequence ENSEMBL: ENSMUSP00000028102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028102]
PDB Structure
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-AlFx [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-VO4 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028102
AA Change: N19S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028102
Gene: ENSMUSG00000026764
AA Change: N19S

DomainStartEndE-ValueType
KISc 6 335 2.8e-173 SMART
low complexity region 340 357 N/A INTRINSIC
coiled coil region 407 541 N/A INTRINSIC
coiled coil region 592 803 N/A INTRINSIC
coiled coil region 826 915 N/A INTRINSIC
Meta Mutation Damage Score 0.4716 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin heavy chain subunit involved in the transport of cargo within the central nervous system. The encoded protein, which acts as a tetramer by associating with another heavy chain and two light chains, interacts with protein kinase CK2. Mutations in this gene have been associated with complex cortical dysplasia with other brain malformations-2. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homezygous for disruptions in this gene are viable, fertile, and of normal size. The brain is normal but slightly reduced in size with decreased numbers of motor neurons an somewhat more sensory nerves than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Kif5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Kif5c APN 2 49694816 missense possibly damaging 0.81
IGL01432:Kif5c APN 2 49701077 missense probably damaging 1.00
IGL01459:Kif5c APN 2 49735557 missense probably benign 0.36
IGL02127:Kif5c APN 2 49701110 splice site probably null
IGL03088:Kif5c APN 2 49744443 missense probably benign 0.01
IGL03379:Kif5c APN 2 49701092 missense probably damaging 0.97
PIT4131001:Kif5c UTSW 2 49694032 missense probably damaging 0.99
PIT4469001:Kif5c UTSW 2 49741348 missense probably benign 0.00
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0116:Kif5c UTSW 2 49752239 splice site probably benign
R0550:Kif5c UTSW 2 49758912 missense possibly damaging 0.53
R0760:Kif5c UTSW 2 49688753 missense probably damaging 1.00
R0967:Kif5c UTSW 2 49698116 unclassified probably benign
R1015:Kif5c UTSW 2 49744365 missense probably benign 0.13
R1758:Kif5c UTSW 2 49723133 missense probably benign 0.00
R1786:Kif5c UTSW 2 49758805 splice site probably benign
R1828:Kif5c UTSW 2 49680240 critical splice donor site probably null
R2130:Kif5c UTSW 2 49758805 splice site probably benign
R2132:Kif5c UTSW 2 49758805 splice site probably benign
R2237:Kif5c UTSW 2 49694008 missense probably benign 0.35
R3970:Kif5c UTSW 2 49688744 missense probably damaging 1.00
R4439:Kif5c UTSW 2 49688725 missense possibly damaging 0.90
R5260:Kif5c UTSW 2 49735590 missense probably damaging 0.99
R5318:Kif5c UTSW 2 49671828 missense probably benign
R5345:Kif5c UTSW 2 49723066 missense probably benign
R5490:Kif5c UTSW 2 49758858 missense probably benign
R5496:Kif5c UTSW 2 49730190 missense possibly damaging 0.69
R5567:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R5570:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R6019:Kif5c UTSW 2 49735509 missense probably benign 0.09
R6688:Kif5c UTSW 2 49688737 missense probably benign 0.06
R7006:Kif5c UTSW 2 49735514 missense probably damaging 0.97
R7009:Kif5c UTSW 2 49757429 missense probably benign
R7081:Kif5c UTSW 2 49741361 missense probably benign 0.00
R7372:Kif5c UTSW 2 49758659 splice site probably null
R7512:Kif5c UTSW 2 49700965 missense probably damaging 1.00
R7549:Kif5c UTSW 2 49701093 missense probably benign 0.11
R7764:Kif5c UTSW 2 49727961 critical splice donor site probably null
R7764:Kif5c UTSW 2 49749327 missense probably damaging 1.00
R7904:Kif5c UTSW 2 49701083 missense probably damaging 1.00
R8292:Kif5c UTSW 2 49735485 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGACCTGCTGAGAAGCTGC -3'
(R):5'- CTAGAGTGGGAACAATAGGCCC -3'

Sequencing Primer
(F):5'- TGCTGAGAAGCTGCGGGAG -3'
(R):5'- CAGGCAAGGGCTCTTTTACGATC -3'
Posted On2017-02-08