Incidental Mutation 'IGL02988:Olfr1052'
ID453467
Institutional Source Beutler Lab
Gene Symbol Olfr1052
Ensembl Gene ENSMUSG00000047149
Gene Nameolfactory receptor 1052
SynonymsGA_x6K02T2Q125-47777498-47778436, MOR172-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #IGL02988 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86292455-86299233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86298479 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 221 (I221T)
Ref Sequence ENSEMBL: ENSMUSP00000149344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054746] [ENSMUST00000215090] [ENSMUST00000217166]
Predicted Effect probably damaging
Transcript: ENSMUST00000054746
AA Change: I221T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058454
Gene: ENSMUSG00000047149
AA Change: I221T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7tm_1 41 290 6.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215090
AA Change: I221T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217166
AA Change: I221T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.3254 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Olfr1052
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02632:Olfr1052 APN 2 86298560 missense probably damaging 0.99
R0382:Olfr1052 UTSW 2 86298593 missense probably damaging 1.00
R0569:Olfr1052 UTSW 2 86298597 missense probably damaging 1.00
R1476:Olfr1052 UTSW 2 86298479 missense probably damaging 0.99
R1510:Olfr1052 UTSW 2 86298371 missense probably damaging 1.00
R1667:Olfr1052 UTSW 2 86298736 missense probably null 0.02
R2912:Olfr1052 UTSW 2 86298389 missense probably damaging 0.96
R2913:Olfr1052 UTSW 2 86298389 missense probably damaging 0.96
R3937:Olfr1052 UTSW 2 86298016 missense probably damaging 1.00
R4299:Olfr1052 UTSW 2 86298241 missense possibly damaging 0.46
R4774:Olfr1052 UTSW 2 86298698 missense possibly damaging 0.91
R5027:Olfr1052 UTSW 2 86298196 missense possibly damaging 0.84
R5080:Olfr1052 UTSW 2 86297914 missense probably benign 0.22
R5254:Olfr1052 UTSW 2 86297921 missense probably damaging 1.00
R5389:Olfr1052 UTSW 2 86298217 missense possibly damaging 0.90
R6110:Olfr1052 UTSW 2 86298675 missense probably damaging 0.99
R6492:Olfr1052 UTSW 2 86298646 missense probably benign 0.05
R6810:Olfr1052 UTSW 2 86297923 missense probably benign 0.01
R7095:Olfr1052 UTSW 2 86298677 missense probably benign 0.08
R7104:Olfr1052 UTSW 2 86298220 missense probably benign
R7320:Olfr1052 UTSW 2 86297994 frame shift probably null
R7328:Olfr1052 UTSW 2 86297994 frame shift probably null
R7363:Olfr1052 UTSW 2 86297994 frame shift probably null
R8048:Olfr1052 UTSW 2 86298328 missense probably benign 0.04
R8202:Olfr1052 UTSW 2 86298624 missense probably benign 0.06
Z1176:Olfr1052 UTSW 2 86298226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATGGTCACTGGGTCAGTC -3'
(R):5'- AGGAATCACCAGTGTATAGAACACC -3'

Sequencing Primer
(F):5'- CACACCATAAGTTTGAGTAAGCTGTC -3'
(R):5'- TGTATAGAACACCGACACCACCTTC -3'
Posted On2017-02-08