Mutagenetix > Incidental Mutation

Incidental Mutation 'R0554:Vwf'

45348

Institutional Source

Beutler Lab

Gene Symbol

Vwf

Ensembl Gene

ENSMUSG00000001930

Gene Name

Von Willebrand factor

Synonyms

6820430P06Rik, B130011O06Rik

MMRRC Submission

038746-MU

Accession Numbers

Genbank: NM_011708; MGI: 98941

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R0554 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125546774-125686679 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 125642781 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1474 (A1474V)

Ref Sequence

ENSEMBL: ENSMUSP00000107873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112254]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000112254
AA Change: A1474V

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: A1474V

Domain	Start	End	E-Value	Type
VWD	23	181	3.43e-35	SMART
C8	221	295	1.11e-21	SMART
Pfam:TIL	298	351	6.9e-15	PFAM
VWC	353	413	8.71e-1	SMART
VWD	380	543	2.93e-52	SMART
C8	580	652	3.82e-25	SMART
Pfam:TIL	655	710	4.1e-14	PFAM
EGF_like	790	825	4.37e1	SMART
VWC	832	901	3.29e-3	SMART
VWD	859	1015	5.15e-39	SMART
C8	1056	1130	1.01e-33	SMART
Pfam:TIL	1144	1199	1.3e-9	PFAM
VWA	1278	1461	1.81e-20	SMART
low complexity region	1464	1477	N/A	INTRINSIC
VWA	1499	1672	8.43e-39	SMART
VWA	1692	1875	2.83e-31	SMART
VWC	1882	1949	2.99e0	SMART
VWD	1941	2104	5.03e-42	SMART
C8	2135	2203	1.29e-13	SMART
Pfam:TIL	2206	2257	8.3e-8	PFAM
VWC	2260	2328	3.16e-16	SMART
low complexity region	2417	2428	N/A	INTRINSIC
VWC	2434	2497	2.61e-17	SMART
VWC	2513	2577	3.37e0	SMART
VWC	2585	2647	2.55e-11	SMART
CT	2730	2815	1.37e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134073

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141521

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	T	A	5: 145,045,371	Y255*	probably null	Het
1810024B03Rik	A	G	2: 127,187,276	M1T	probably null	Het
4930503L19Rik	T	C	18: 70,467,380	D386G	probably damaging	Het
Ace2	T	A	X: 164,175,951	N601K	probably benign	Het
Adam4	A	C	12: 81,421,424	I141R	probably damaging	Het
Adcy10	G	A	1: 165,513,130	G235S	probably benign	Het
Adcy5	G	A	16: 35,294,017	V997I	probably benign	Het
Aff2	T	G	X: 69,864,074	W1221G	possibly damaging	Het
Ankrd44	T	C	1: 54,763,758	N194D	probably benign	Het
Apba2	T	G	7: 64,745,780	L668R	probably damaging	Het
Asph	T	C	4: 9,604,581	D152G	probably damaging	Het
Bcl3	C	G	7: 19,820,066	V126L	probably benign	Het
Cd163	A	G	6: 124,312,660	T446A	probably benign	Het
Cd209g	C	T	8: 4,134,995		probably benign	Het
Cdadc1	A	T	14: 59,586,452	V197E	probably damaging	Het
CN725425	T	C	15: 91,260,763	C610R	possibly damaging	Het
Col6a2	A	G	10: 76,611,161		probably null	Het
Coro7	A	G	16: 4,632,257	L576P	possibly damaging	Het
Dgkb	T	A	12: 38,216,031	V503E	probably benign	Het
Dhx57	A	T	17: 80,260,236	L806*	probably null	Het
Dlec1	T	C	9: 119,115,002	V373A	probably benign	Het
Dnah11	G	T	12: 117,931,178	R3645S	probably benign	Het
Dnhd1	T	C	7: 105,694,395	S1649P	probably benign	Het
Draxin	T	G	4: 148,107,963	K297N	probably damaging	Het
Epha7	T	C	4: 28,951,401	S841P	probably damaging	Het
Esp8	T	G	17: 40,530,275	D142E	unknown	Het
F5	T	G	1: 164,179,449	V274G	probably damaging	Het
Fancc	T	C	13: 63,317,469	S475G	probably benign	Het
Fmo3	T	C	1: 162,954,332	N484S	probably benign	Het
Focad	T	C	4: 88,348,889	Y1046H	unknown	Het
Furin	C	T	7: 80,391,284	G602D	probably damaging	Het
Fut8	A	T	12: 77,364,970	I69L	probably benign	Het
Gm10436	T	C	12: 88,177,558	T162A	probably benign	Het
Gm4951	G	A	18: 60,245,417	R8H	probably benign	Het
Gnai3	A	G	3: 108,123,612	I78T	probably benign	Het
Gpr182	T	C	10: 127,751,071	I4V	probably benign	Het
Gpr63	T	C	4: 25,007,447	M57T	probably benign	Het
Grm1	T	A	10: 10,719,923	T654S	probably benign	Het
Gtf2h4	T	C	17: 35,668,639	T371A	probably benign	Het
Helq	T	C	5: 100,790,200	N460S	probably benign	Het
Hmcn1	T	C	1: 150,719,117	N1867S	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Inpp5j	A	G	11: 3,499,644	Y713H	probably damaging	Het
Ints6	A	T	14: 62,704,751	V511D	possibly damaging	Het
Itga4	A	G	2: 79,279,117	Y220C	probably damaging	Het
Itgav	T	G	2: 83,794,270	S735A	possibly damaging	Het
Kctd16	A	G	18: 40,258,439	I27V	probably benign	Het
Klhl6	T	C	16: 19,953,593	E334G	probably damaging	Het
Lrmp	G	A	6: 145,165,287	A237T	probably benign	Het
Ltbp1	T	A	17: 75,225,279	L116H	probably damaging	Het
Magohb	T	A	6: 131,285,697	H98L	probably benign	Het
Mgat2	A	G	12: 69,185,392	T247A	probably benign	Het
Mtif2	G	A	11: 29,533,398		probably null	Het
Myrfl	T	C	10: 116,828,973	E384G	probably damaging	Het
Nfam1	G	T	15: 83,033,209	R8S	probably benign	Het
Numa1	T	C	7: 101,995,524	S236P	possibly damaging	Het
Olfr1022	T	C	2: 85,869,519	F309S	probably benign	Het
Olfr310	A	T	7: 86,269,657	I44N	probably damaging	Het
Olfr317	T	C	11: 58,733,039	N42S	probably damaging	Het
Olfr777	T	C	10: 129,268,499	T275A	probably benign	Het
Orc4	C	T	2: 48,905,421	S431N	probably benign	Het
Pax2	T	C	19: 44,761,861	V129A	probably damaging	Het
Pcdhb15	A	G	18: 37,474,519	D268G	probably damaging	Het
Pdcd1	G	A	1: 94,039,382	R264C	probably damaging	Het
Pi15	T	A	1: 17,621,648	M187K	probably benign	Het
Plag1	C	T	4: 3,904,546	C215Y	probably damaging	Het
Plagl1	A	G	10: 13,127,182	T65A	probably benign	Het
Prss48	T	A	3: 86,000,921	Q18L	probably benign	Het
Prune2	T	A	19: 17,125,218	C2580*	probably null	Het
Rab40b	T	A	11: 121,359,606	Q74L	probably damaging	Het
Raf1	A	G	6: 115,623,530	I376T	probably benign	Het
Rbm46	A	T	3: 82,865,268	F186I	probably damaging	Het
Reps1	C	T	10: 18,123,119	T720M	possibly damaging	Het
Rgs22	A	G	15: 36,054,709	M649T	probably benign	Het
Rhot1	C	T	11: 80,243,438	R47*	probably null	Het
Rhox2f	A	G	X: 37,571,471	Y8C	possibly damaging	Het
Rnf17	A	G	14: 56,522,550	Y1604C	probably damaging	Het
Rnf40	T	C	7: 127,602,584	C943R	probably damaging	Het
Ropn1l	A	T	15: 31,451,149	M63K	probably benign	Het
Sbf2	C	A	7: 110,428,287	V501F	probably damaging	Het
Sh3bp1	T	A	15: 78,907,267	M354K	probably damaging	Het
Sipa1l3	T	C	7: 29,388,030	H590R	possibly damaging	Het
Slco6d1	T	A	1: 98,466,697	C369S	probably benign	Het
Sulf1	T	C	1: 12,805,194	Y143H	probably damaging	Het
Tiam2	A	T	17: 3,438,681	R755*	probably null	Het
Trim12c	C	A	7: 104,344,962	L228F	probably damaging	Het
Ttc23l	G	T	15: 10,530,657	Q290K	probably benign	Het
Uba3	T	C	6: 97,191,260		probably null	Het
Ugt1a10	A	G	1: 88,056,095	E205G	probably damaging	Het
Ugt3a2	T	A	15: 9,351,120	S72T	probably benign	Het
Upk3bl	C	T	5: 136,059,794	T113I	probably damaging	Het
Uspl1	T	A	5: 149,187,834	D20E	probably damaging	Het
Vmn2r19	G	A	6: 123,336,143	G724E	probably damaging	Het
Vmn2r63	T	A	7: 42,933,705	K29*	probably null	Het
Xpc	C	T	6: 91,491,226	A860T	probably benign	Het
Zfp462	A	G	4: 55,013,689	H737R	probably damaging	Het
Zfp536	T	C	7: 37,480,819	D787G	probably damaging	Het
Zfp692	A	G	11: 58,314,227	H434R	probably damaging	Het
Zp1	C	A	19: 10,920,562	C5F	probably benign	Het

Other mutations in Vwf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Vwf	APN	6	125658872	missense	unknown
IGL00561:Vwf	APN	6	125642721	missense	possibly damaging	0.88
IGL01104:Vwf	APN	6	125683556	missense	probably damaging	1.00
IGL01404:Vwf	APN	6	125677970	missense	probably damaging	1.00
IGL01539:Vwf	APN	6	125590262	missense	possibly damaging	0.85
IGL01550:Vwf	APN	6	125679289	missense	probably benign	0.00
IGL01563:Vwf	APN	6	125591165	missense	probably damaging	1.00
IGL01637:Vwf	APN	6	125645736	missense	probably damaging	1.00
IGL01720:Vwf	APN	6	125642835	missense	possibly damaging	0.69
IGL01834:Vwf	APN	6	125590170	splice site	probably benign
IGL02103:Vwf	APN	6	125646355	missense	probably damaging	1.00
IGL02120:Vwf	APN	6	125616034	missense	probably benign	0.26
IGL02174:Vwf	APN	6	125555395	missense	probably damaging	1.00
IGL02203:Vwf	APN	6	125642406	missense	probably damaging	1.00
IGL02420:Vwf	APN	6	125677916	missense	probably benign	0.00
IGL02723:Vwf	APN	6	125642930	missense	possibly damaging	0.85
IGL02818:Vwf	APN	6	125663548	missense	probably benign
IGL02931:Vwf	APN	6	125615968	missense	possibly damaging	0.68
IGL03015:Vwf	APN	6	125684138	splice site	probably benign
IGL03038:Vwf	APN	6	125604157	missense	possibly damaging	0.92
IGL03060:Vwf	APN	6	125663560	missense	probably damaging	1.00
IGL03114:Vwf	APN	6	125599363	nonsense	probably null
IGL03266:Vwf	APN	6	125678077	splice site	probably benign
gingerman	UTSW	6	125662963	critical splice acceptor site	probably null
R0605_vwf_644	UTSW	6	125685837	missense	probably benign	0.02
R1575_Vwf_091	UTSW	6	125663571	nonsense	probably null
R1628_Vwf_608	UTSW	6	125647738	unclassified	probably benign
R1669_Vwf_448	UTSW	6	125647906	missense	possibly damaging	0.92
R1833_Vwf_948	UTSW	6	125642037	missense	probably benign	0.14
R2130_vwf_946	UTSW	6	125657057	missense	probably damaging	1.00
R6360_Vwf_065	UTSW	6	125683526	missense	probably benign	0.13
R7900_Vwf_938	UTSW	6	125628476	critical splice donor site	probably null
Russiahouse	UTSW	6	125639341	nonsense	probably null
B5639:Vwf	UTSW	6	125642984	missense	probably damaging	1.00
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0087:Vwf	UTSW	6	125645954	missense	probably benign	0.03
R0194:Vwf	UTSW	6	125643297	missense	probably benign
R0206:Vwf	UTSW	6	125637456	missense	probably damaging	1.00
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0390:Vwf	UTSW	6	125626361	nonsense	probably null
R0427:Vwf	UTSW	6	125673939	missense	probably benign
R0437:Vwf	UTSW	6	125566318	missense	probably damaging	1.00
R0470:Vwf	UTSW	6	125628428	missense	possibly damaging	0.70
R0499:Vwf	UTSW	6	125638114	missense	probably benign	0.10
R0605:Vwf	UTSW	6	125685837	missense	probably benign	0.02
R0711:Vwf	UTSW	6	125626271	missense	probably benign	0.01
R0723:Vwf	UTSW	6	125566262	missense	probably benign	0.01
R0973:Vwf	UTSW	6	125643006	missense	probably damaging	1.00
R1054:Vwf	UTSW	6	125590227	missense	probably damaging	1.00
R1115:Vwf	UTSW	6	125655065	missense	unknown
R1156:Vwf	UTSW	6	125637488	missense	probably damaging	1.00
R1191:Vwf	UTSW	6	125599252	missense	probably damaging	1.00
R1240:Vwf	UTSW	6	125603308	splice site	probably null
R1398:Vwf	UTSW	6	125603457	missense	probably benign	0.02
R1435:Vwf	UTSW	6	125642249	nonsense	probably null
R1528:Vwf	UTSW	6	125608291	missense	possibly damaging	0.69
R1575:Vwf	UTSW	6	125655251	missense	unknown
R1575:Vwf	UTSW	6	125663571	nonsense	probably null
R1628:Vwf	UTSW	6	125647738	unclassified	probably benign
R1669:Vwf	UTSW	6	125647906	missense	possibly damaging	0.92
R1699:Vwf	UTSW	6	125643069	missense	probably damaging	1.00
R1699:Vwf	UTSW	6	125685900	missense	possibly damaging	0.74
R1725:Vwf	UTSW	6	125646282	missense	probably benign	0.05
R1742:Vwf	UTSW	6	125667550	missense	probably benign	0.02
R1809:Vwf	UTSW	6	125590175	splice site	probably benign
R1833:Vwf	UTSW	6	125642037	missense	probably benign	0.14
R1866:Vwf	UTSW	6	125667529	missense	possibly damaging	0.62
R1870:Vwf	UTSW	6	125642939	missense	probably damaging	1.00
R1874:Vwf	UTSW	6	125628372	missense	probably benign	0.00
R1941:Vwf	UTSW	6	125639279	missense	possibly damaging	0.64
R2061:Vwf	UTSW	6	125591188	missense	probably damaging	0.98
R2103:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2104:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2130:Vwf	UTSW	6	125657057	missense	probably damaging	1.00
R2159:Vwf	UTSW	6	125626341	missense	probably damaging	0.99
R2178:Vwf	UTSW	6	125642132	missense	possibly damaging	0.90
R2656:Vwf	UTSW	6	125555361	missense	probably benign	0.00
R2913:Vwf	UTSW	6	125685846	missense	probably benign	0.08
R2917:Vwf	UTSW	6	125608143	missense	probably benign	0.07
R3726:Vwf	UTSW	6	125677948	utr 3 prime	probably benign
R3735:Vwf	UTSW	6	125588613	missense	probably damaging	1.00
R3774:Vwf	UTSW	6	125649099	splice site	probably null
R3934:Vwf	UTSW	6	125555499	missense	probably damaging	1.00
R4291:Vwf	UTSW	6	125642322	missense	probably damaging	1.00
R4384:Vwf	UTSW	6	125655116	missense	unknown
R4743:Vwf	UTSW	6	125684091	critical splice acceptor site	probably null
R4760:Vwf	UTSW	6	125570604	missense	probably damaging	1.00
R4776:Vwf	UTSW	6	125566305	missense	possibly damaging	0.53
R4791:Vwf	UTSW	6	125643363	missense
R4871:Vwf	UTSW	6	125686462	missense	probably benign	0.25
R4894:Vwf	UTSW	6	125645934	nonsense	probably null
R4963:Vwf	UTSW	6	125667483	nonsense	probably null
R5010:Vwf	UTSW	6	125566257	missense	probably benign	0.15
R5289:Vwf	UTSW	6	125667510	utr 3 prime	probably benign
R5512:Vwf	UTSW	6	125673887	utr 3 prime	probably benign
R5523:Vwf	UTSW	6	125643042	missense
R5642:Vwf	UTSW	6	125603418	missense
R5860:Vwf	UTSW	6	125643090	missense
R5860:Vwf	UTSW	6	125679265	utr 3 prime	probably benign
R5896:Vwf	UTSW	6	125678762	critical splice acceptor site	probably null
R5926:Vwf	UTSW	6	125604174	missense	probably damaging	1.00
R5976:Vwf	UTSW	6	125603463	missense
R6053:Vwf	UTSW	6	125600665	missense	probably benign	0.21
R6151:Vwf	UTSW	6	125657065	missense	unknown
R6179:Vwf	UTSW	6	125649289	missense	unknown
R6181:Vwf	UTSW	6	125566146	missense	probably damaging	0.98
R6234:Vwf	UTSW	6	125657165	missense	unknown
R6360:Vwf	UTSW	6	125683526	missense	probably benign	0.13
R6412:Vwf	UTSW	6	125679316	missense	probably benign	0.00
R6464:Vwf	UTSW	6	125639400	critical splice donor site	probably null
R6522:Vwf	UTSW	6	125662963	critical splice acceptor site	probably null
R6766:Vwf	UTSW	6	125639376	missense	unknown
R6856:Vwf	UTSW	6	125642150	nonsense	probably null
R6877:Vwf	UTSW	6	125657201	missense	possibly damaging	0.48
R6896:Vwf	UTSW	6	125566194	missense	probably damaging	1.00
R7113:Vwf	UTSW	6	125655044	missense
R7287:Vwf	UTSW	6	125637467	missense
R7359:Vwf	UTSW	6	125566257	missense
R7509:Vwf	UTSW	6	125642169	missense
R7519:Vwf	UTSW	6	125667543	missense
R7545:Vwf	UTSW	6	125614097	missense
R7549:Vwf	UTSW	6	125626267	missense
R7593:Vwf	UTSW	6	125647768	missense
R7635:Vwf	UTSW	6	125682734	missense
R7793:Vwf	UTSW	6	125686520	missense
R7802:Vwf	UTSW	6	125666677	missense
R7824:Vwf	UTSW	6	125658815	missense
R7849:Vwf	UTSW	6	125656803	missense
R7900:Vwf	UTSW	6	125628476	critical splice donor site	probably null
R7919:Vwf	UTSW	6	125647859	missense
R7966:Vwf	UTSW	6	125639341	nonsense	probably null
R8101:Vwf	UTSW	6	125570559	nonsense	probably null
R8162:Vwf	UTSW	6	125645836	splice site	probably null
R8345:Vwf	UTSW	6	125679302	missense
R8853:Vwf	UTSW	6	125657264	missense
R9027:Vwf	UTSW	6	125666663	missense
R9065:Vwf	UTSW	6	125646299	missense
R9068:Vwf	UTSW	6	125648829	unclassified	probably benign
R9128:Vwf	UTSW	6	125642730	missense
R9136:Vwf	UTSW	6	125599393	splice site	probably benign
R9164:Vwf	UTSW	6	125565843	missense
R9177:Vwf	UTSW	6	125604291	missense
R9334:Vwf	UTSW	6	125677946	missense
R9508:Vwf	UTSW	6	125555508	missense
R9553:Vwf	UTSW	6	125600699	missense
R9660:Vwf	UTSW	6	125591707	missense	possibly damaging	0.61
R9706:Vwf	UTSW	6	125624573	missense
R9708:Vwf	UTSW	6	125657090	missense
R9712:Vwf	UTSW	6	125624573	missense
R9714:Vwf	UTSW	6	125624573	missense
R9728:Vwf	UTSW	6	125591707	missense	possibly damaging	0.61
R9758:Vwf	UTSW	6	125626267	missense
X0021:Vwf	UTSW	6	125646331	missense	probably damaging	1.00
X0065:Vwf	UTSW	6	125603433	missense	probably null	0.05
Z1176:Vwf	UTSW	6	125591231	missense
Z1176:Vwf	UTSW	6	125603308	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AAATTGACCGCCCTGAAGCCTC -3'
(R):5'- TCACGTCCATGCGCTGGATTAC -3'

Sequencing Primer
(F):5'- CGCTATGTCCAAGGTCTGAAG -3'
(R):5'- TGGATTACCTCCTCCACGAAC -3'

Posted On

2013-06-11