Incidental Mutation 'IGL02988:Pkd2'
ID453483
Institutional Source Beutler Lab
Gene Symbol Pkd2
Ensembl Gene ENSMUSG00000034462
Gene Namepolycystic kidney disease 2
SynonymsC030034P18Rik, TRPP2, polycystin-2, PC2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02988 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104459450-104505819 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 104503605 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 940 (R940*)
Ref Sequence ENSEMBL: ENSMUSP00000084041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086831] [ENSMUST00000096452]
Predicted Effect probably null
Transcript: ENSMUST00000086831
AA Change: R940*
SMART Domains Protein: ENSMUSP00000084041
Gene: ENSMUSG00000034462
AA Change: R940*

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
Pfam:PKD_channel 265 685 1.3e-171 PFAM
Pfam:Ion_trans 454 690 2.6e-25 PFAM
coiled coil region 765 794 N/A INTRINSIC
PDB:3HRN|A 834 893 8e-31 PDB
low complexity region 900 915 N/A INTRINSIC
low complexity region 949 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096452
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133540
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Pkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pkd2 APN 5 104483135 missense probably damaging 1.00
IGL01527:Pkd2 APN 5 104498884 splice site probably benign
IGL01805:Pkd2 APN 5 104483093 missense probably benign 0.41
IGL02146:Pkd2 APN 5 104489291 missense probably damaging 1.00
IGL02326:Pkd2 APN 5 104477075 missense probably benign 0.38
IGL02481:Pkd2 APN 5 104486770 missense probably damaging 1.00
IGL02952:Pkd2 APN 5 104480160 missense possibly damaging 0.48
IGL03026:Pkd2 APN 5 104494887 splice site probably benign
IGL03409:Pkd2 APN 5 104489349 nonsense probably null
Nephro UTSW 5 104486806 missense probably damaging 1.00
reggae UTSW 5 104477179 splice site probably null
samba UTSW 5 104477123 missense probably benign 0.01
PIT1430001:Pkd2 UTSW 5 104459788 missense probably damaging 0.99
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0045:Pkd2 UTSW 5 104455805 unclassified probably benign
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0315:Pkd2 UTSW 5 104459850 missense possibly damaging 0.94
R0316:Pkd2 UTSW 5 104477166 missense probably damaging 1.00
R0570:Pkd2 UTSW 5 104455605 unclassified probably benign
R1277:Pkd2 UTSW 5 104502359 missense probably damaging 0.97
R1883:Pkd2 UTSW 5 104483228 missense probably damaging 1.00
R1907:Pkd2 UTSW 5 104486806 missense probably damaging 1.00
R1937:Pkd2 UTSW 5 104478924 missense probably damaging 1.00
R2023:Pkd2 UTSW 5 104466878 splice site probably null
R2080:Pkd2 UTSW 5 104477123 missense probably benign 0.01
R2081:Pkd2 UTSW 5 104460211 missense probably benign 0.00
R2098:Pkd2 UTSW 5 104478902 missense probably damaging 1.00
R2117:Pkd2 UTSW 5 104483176 missense probably damaging 1.00
R2146:Pkd2 UTSW 5 104455590 unclassified probably benign
R2163:Pkd2 UTSW 5 104455677 unclassified probably benign
R3401:Pkd2 UTSW 5 104480327 missense possibly damaging 0.68
R3732:Pkd2 UTSW 5 104489419 splice site probably null
R3733:Pkd2 UTSW 5 104489419 splice site probably null
R4409:Pkd2 UTSW 5 104466884 splice site silent
R4582:Pkd2 UTSW 5 104502344 nonsense probably null
R5189:Pkd2 UTSW 5 104459919 missense probably benign 0.22
R5191:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5195:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5198:Pkd2 UTSW 5 104483092 missense probably benign 0.06
R5326:Pkd2 UTSW 5 104486649 splice site silent
R5406:Pkd2 UTSW 5 104480332 missense probably damaging 1.00
R5542:Pkd2 UTSW 5 104486649 splice site silent
R5543:Pkd2 UTSW 5 104489333 missense probably damaging 1.00
R5633:Pkd2 UTSW 5 104498506 missense probably damaging 0.98
R5887:Pkd2 UTSW 5 104498539 missense probably damaging 1.00
R5906:Pkd2 UTSW 5 104477179 splice site probably null
R5924:Pkd2 UTSW 5 104498558 missense probably damaging 0.99
R6361:Pkd2 UTSW 5 104486680 nonsense probably null
R6455:Pkd2 UTSW 5 104459924 missense probably benign 0.00
R6495:Pkd2 UTSW 5 104489293 missense probably damaging 1.00
R6735:Pkd2 UTSW 5 104480329 missense probably damaging 1.00
R6837:Pkd2 UTSW 5 104477043 missense probably damaging 1.00
R7192:Pkd2 UTSW 5 104486657 missense probably benign 0.00
R7477:Pkd2 UTSW 5 104483242 missense probably benign 0.19
R7560:Pkd2 UTSW 5 104480353 missense probably damaging 1.00
R7867:Pkd2 UTSW 5 104483120 missense probably damaging 1.00
R7894:Pkd2 UTSW 5 104480237 missense probably damaging 1.00
R8251:Pkd2 UTSW 5 104498487 missense probably benign 0.01
Z1088:Pkd2 UTSW 5 104498861 missense probably damaging 1.00
Z1176:Pkd2 UTSW 5 104460049 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AATCCCTTGTCAGGATGCGC -3'
(R):5'- TGAACCACGGGTTTAAGTTTACG -3'

Sequencing Primer
(F):5'- CTTGTCAGGATGCGCGACTG -3'
(R):5'- CATCATAATGCAGCCGGGG -3'
Posted On2017-02-08