Incidental Mutation 'IGL02988:Fam20c'
ID453486
Institutional Source Beutler Lab
Gene Symbol Fam20c
Ensembl Gene ENSMUSG00000025854
Gene Namefamily with sequence similarity 20, member C
SynonymsDMP4
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #IGL02988 (G1)
Quality Score159
Status Validated
Chromosome5
Chromosomal Location138754514-138810077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138755994 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 120 (E120V)
Ref Sequence ENSEMBL: ENSMUSP00000124584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026972] [ENSMUST00000160645]
Predicted Effect probably benign
Transcript: ENSMUST00000026972
AA Change: E120V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026972
Gene: ENSMUSG00000025854
AA Change: E120V

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Pfam:Fam20C 349 565 4.5e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160645
AA Change: E120V

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124584
Gene: ENSMUSG00000025854
AA Change: E120V

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197027
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of secreted protein kinases. The encoded protein binds calcium and phosphorylates proteins involved in bone mineralization. Mutations in this gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice with global conditional deletion of this gene display infertility, dwarfism, delayed bone ossification, reduced bone mineralization, fragile skeletons, hypophosphatemic rickets, and impaired osteoblast differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Fam20c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fam20c APN 5 138809157 missense probably benign
IGL01096:Fam20c APN 5 138809155 missense possibly damaging 0.93
IGL01393:Fam20c APN 5 138807271 missense probably damaging 1.00
IGL01576:Fam20c APN 5 138807339 missense probably damaging 0.98
IGL01960:Fam20c APN 5 138806320 missense probably damaging 0.99
IGL02317:Fam20c APN 5 138806360 missense probably damaging 1.00
IGL02979:Fam20c APN 5 138757865 missense probably damaging 1.00
R0197:Fam20c UTSW 5 138755724 missense probably damaging 1.00
R0594:Fam20c UTSW 5 138766637 missense possibly damaging 0.94
R0615:Fam20c UTSW 5 138807486 missense probably damaging 0.99
R1672:Fam20c UTSW 5 138807301 missense probably damaging 1.00
R2044:Fam20c UTSW 5 138756227 critical splice donor site probably null
R2484:Fam20c UTSW 5 138809117 missense probably benign
R3418:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R3419:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R4205:Fam20c UTSW 5 138755676 missense probably damaging 1.00
R5966:Fam20c UTSW 5 138756177 missense probably damaging 1.00
R6346:Fam20c UTSW 5 138766695 missense probably damaging 1.00
R7290:Fam20c UTSW 5 138807554 missense probably damaging 1.00
R7559:Fam20c UTSW 5 138793199 missense possibly damaging 0.91
R8321:Fam20c UTSW 5 138757931 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTGTTGACCTGCTACCCAAG -3'
(R):5'- TTCACATTAAACAGGACGTCGTC -3'

Sequencing Primer
(F):5'- TACCCAAGCTGGACCGACG -3'
(R):5'- ACGTCGTCCTCTGTCAGAG -3'
Posted On2017-02-08