Incidental Mutation 'IGL02988:Siglecg'
ID 453490
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Name sialic acid binding Ig-like lectin G
Synonyms A630096C01Rik, mSiglec-G
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # IGL02988 (G1)
Quality Score 171
Status Validated
Chromosome 7
Chromosomal Location 43057623-43067773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43067476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 681 (D681V)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
AlphaFold Q80ZE3
Predicted Effect probably damaging
Transcript: ENSMUST00000005592
AA Change: D681V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: D681V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154322
Meta Mutation Damage Score 0.3027 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Aadacl4fm5 T A 4: 144,513,100 (GRCm39) probably benign Het
Adgrd1 G A 5: 129,221,074 (GRCm39) A488T probably benign Het
Ano3 T C 2: 110,605,355 (GRCm39) S284G probably damaging Het
Aox1 G T 1: 58,376,509 (GRCm39) V897L probably benign Het
Arl6 T A 16: 59,434,209 (GRCm39) probably null Het
Blnk G A 19: 40,917,660 (GRCm39) T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 (GRCm39) T1221I probably benign Het
Cbll1 A T 12: 31,542,171 (GRCm39) F63L possibly damaging Het
Cdk14 A G 5: 5,086,484 (GRCm39) Y279H probably damaging Het
Cflar A T 1: 58,780,190 (GRCm39) I265F possibly damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Cyp3a13 A T 5: 137,897,272 (GRCm39) Y347* probably null Het
Defa27 T C 8: 21,805,583 (GRCm39) S8P probably damaging Het
Depdc5 A C 5: 33,113,511 (GRCm39) probably null Het
Dlg5 A G 14: 24,216,323 (GRCm39) F573S probably damaging Het
Fam20c A T 5: 138,741,749 (GRCm39) E120V probably benign Het
Fam53a T C 5: 33,764,819 (GRCm39) K296E probably damaging Het
Fcna G C 2: 25,520,693 (GRCm39) probably benign Het
Fndc1 T C 17: 7,972,355 (GRCm39) T1526A possibly damaging Het
Gm14325 A C 2: 177,476,042 (GRCm39) probably null Het
Gm7582 G A 1: 85,019,588 (GRCm39) noncoding transcript Het
Golga7b A C 19: 42,255,239 (GRCm39) Y63S probably damaging Het
Hexb A G 13: 97,334,729 (GRCm39) L14P unknown Het
Hsd17b3 A C 13: 64,236,914 (GRCm39) L10R probably damaging Het
Il6st T C 13: 112,635,420 (GRCm39) F611L probably damaging Het
Ints13 T A 6: 146,457,646 (GRCm39) T411S possibly damaging Het
Kif18b C A 11: 102,799,146 (GRCm39) C685F probably damaging Het
Kif5c A G 2: 49,509,729 (GRCm39) N19S probably damaging Het
Lmbr1 G T 5: 29,497,221 (GRCm39) probably null Het
Minar1 A G 9: 89,484,792 (GRCm39) S202P probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrc2 G A 11: 105,216,397 (GRCm39) R62Q probably benign Het
Myo1g T C 11: 6,458,183 (GRCm39) probably benign Het
Myo5a A T 9: 75,037,423 (GRCm39) probably benign Het
Nobox G A 6: 43,282,095 (GRCm39) S326L possibly damaging Het
Nsl1 C A 1: 190,795,300 (GRCm39) S22* probably null Het
Or5b3 A C 19: 13,388,826 (GRCm39) K298Q possibly damaging Het
Or5j3 T C 2: 86,128,823 (GRCm39) I221T probably damaging Het
Pdia3 T A 2: 121,260,037 (GRCm39) L192Q probably damaging Het
Pkd2 A T 5: 104,651,471 (GRCm39) R940* probably null Het
Plcd3 T A 11: 102,967,568 (GRCm39) Q458L probably benign Het
Polm T A 11: 5,786,343 (GRCm39) T75S probably benign Het
Pon3 T A 6: 5,232,330 (GRCm39) D230V possibly damaging Het
Pxdn A T 12: 30,053,113 (GRCm39) K917* probably null Het
Rad54l2 A G 9: 106,577,784 (GRCm39) S1046P probably benign Het
Rb1cc1 T C 1: 6,318,035 (GRCm39) probably null Het
Rnf215 A G 11: 4,086,785 (GRCm39) E194G probably damaging Het
Rorb A T 19: 18,915,336 (GRCm39) F441I probably damaging Het
Sel1l2 C A 2: 140,090,508 (GRCm39) G378V probably damaging Het
Sema6a G T 18: 47,431,281 (GRCm39) A139D probably damaging Het
Serpinb3d A T 1: 107,006,266 (GRCm39) M274K probably benign Het
Siglec15 A C 18: 78,092,462 (GRCm39) L32R probably damaging Het
Slc6a13 G T 6: 121,303,066 (GRCm39) probably benign Het
Slc9b2 G T 3: 135,024,179 (GRCm39) A77S probably benign Het
Slit3 T A 11: 35,598,890 (GRCm39) V1498D probably damaging Het
Snorc A G 1: 87,402,926 (GRCm39) probably null Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Stxbp2 T C 8: 3,683,267 (GRCm39) probably benign Het
Tbc1d9b T C 11: 50,042,773 (GRCm39) S482P possibly damaging Het
Tec A G 5: 72,926,090 (GRCm39) S321P possibly damaging Het
Tenm3 A G 8: 48,688,381 (GRCm39) M2402T probably damaging Het
Thrap3 G A 4: 126,059,335 (GRCm39) probably null Het
Tm4sf1 A T 3: 57,200,537 (GRCm39) probably null Het
Tmcc1 T C 6: 116,019,889 (GRCm39) E306G probably damaging Het
Traf3ip3 A T 1: 192,877,182 (GRCm39) probably null Het
Utf1 C T 7: 139,523,875 (GRCm39) P30L possibly damaging Het
Wdfy3 A T 5: 102,077,847 (GRCm39) C880S probably damaging Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43,058,481 (GRCm39) missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43,061,219 (GRCm39) missense probably benign 0.02
IGL01806:Siglecg APN 7 43,060,888 (GRCm39) splice site probably null
IGL01947:Siglecg APN 7 43,058,187 (GRCm39) missense probably benign 0.43
IGL02257:Siglecg APN 7 43,061,328 (GRCm39) missense probably benign 0.00
IGL02410:Siglecg APN 7 43,058,253 (GRCm39) missense probably damaging 0.99
IGL02454:Siglecg APN 7 43,058,319 (GRCm39) missense probably benign 0.00
Chamonix UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
Dollywood UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
glowworm UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
Montblanc UTSW 7 43,060,810 (GRCm39) intron probably benign
Shenandoah UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
shenandoah2 UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
Sherando UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
Smokies UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
R0134:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0225:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0480:Siglecg UTSW 7 43,060,550 (GRCm39) missense probably benign 0.42
R1538:Siglecg UTSW 7 43,067,313 (GRCm39) missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43,058,365 (GRCm39) missense probably benign 0.17
R2358:Siglecg UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43,067,332 (GRCm39) missense probably benign 0.03
R4754:Siglecg UTSW 7 43,061,295 (GRCm39) intron probably benign
R5017:Siglecg UTSW 7 43,060,810 (GRCm39) intron probably benign
R5713:Siglecg UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
R5777:Siglecg UTSW 7 43,058,837 (GRCm39) missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43,061,628 (GRCm39) intron probably benign
R6153:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43,058,178 (GRCm39) missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43,058,403 (GRCm39) missense probably benign 0.00
R7066:Siglecg UTSW 7 43,061,166 (GRCm39) missense probably benign 0.40
R7884:Siglecg UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
R8275:Siglecg UTSW 7 43,061,892 (GRCm39) missense probably benign
R8554:Siglecg UTSW 7 43,058,320 (GRCm39) missense probably benign 0.01
R8846:Siglecg UTSW 7 43,061,942 (GRCm39) missense probably benign 0.02
R8873:Siglecg UTSW 7 43,067,448 (GRCm39) missense probably benign 0.00
R8887:Siglecg UTSW 7 43,058,008 (GRCm39) missense probably benign 0.18
R9012:Siglecg UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
R9032:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9048:Siglecg UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
R9085:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9313:Siglecg UTSW 7 43,061,856 (GRCm39) missense probably benign 0.03
R9320:Siglecg UTSW 7 43,058,853 (GRCm39) missense probably benign 0.33
R9745:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 0.98
RF006:Siglecg UTSW 7 43,058,288 (GRCm39) nonsense probably null
Z1177:Siglecg UTSW 7 43,061,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCAGATGCCCCTTCTAG -3'
(R):5'- CCAAACAGGAGCCATCATCTTTAG -3'

Sequencing Primer
(F):5'- AGATGCCCCTTCTAGGAGCTC -3'
(R):5'- GTCCTCGGGATCAATCTAAGAGTTC -3'
Posted On 2017-02-08