Incidental Mutation 'IGL02988:Mmp1a'
ID453495
Institutional Source Beutler Lab
Gene Symbol Mmp1a
Ensembl Gene ENSMUSG00000043089
Gene Namematrix metallopeptidase 1a (interstitial collagenase)
SynonymsMcol-A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #IGL02988 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location7464141-7476869 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TG to TGG at 7465083 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034492] [ENSMUST00000217651]
Predicted Effect probably null
Transcript: ENSMUST00000034492
SMART Domains Protein: ENSMUSP00000034492
Gene: ENSMUSG00000043089

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 25 84 8.2e-14 PFAM
ZnMc 97 259 2.99e-44 SMART
HX 281 323 8.12e-6 SMART
HX 325 369 7.81e-8 SMART
HX 374 421 5.82e-16 SMART
HX 423 463 2.18e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217651
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens. Mice lacking the encoded protein exhibit decreased susceptibility to chemical carcinogen-induced lung tumor development and angiogenesis. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced inflammatory response following chemical induction of tumors and male mice exhibit fewer large induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Mmp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Mmp1a APN 9 7476259 missense probably benign 0.04
IGL02179:Mmp1a APN 9 7464273 missense probably benign 0.23
IGL02738:Mmp1a APN 9 7464301 splice site probably benign
IGL02984:Mmp1a UTSW 9 7465083 makesense probably null
IGL02991:Mmp1a UTSW 9 7465083 makesense probably null
IGL03014:Mmp1a UTSW 9 7465083 makesense probably null
IGL03050:Mmp1a UTSW 9 7465083 makesense probably null
IGL03054:Mmp1a UTSW 9 7465083 makesense probably null
IGL03055:Mmp1a UTSW 9 7465083 makesense probably null
IGL03097:Mmp1a UTSW 9 7465083 makesense probably null
IGL03098:Mmp1a UTSW 9 7465083 makesense probably null
IGL03134:Mmp1a UTSW 9 7465083 makesense probably null
IGL03138:Mmp1a UTSW 9 7465083 makesense probably null
IGL03147:Mmp1a UTSW 9 7465083 makesense probably null
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R1422:Mmp1a UTSW 9 7464298 splice site probably null
R1663:Mmp1a UTSW 9 7465656 missense probably benign 0.33
R1801:Mmp1a UTSW 9 7475390 missense probably damaging 1.00
R2171:Mmp1a UTSW 9 7475356 missense probably damaging 0.99
R3415:Mmp1a UTSW 9 7464869 missense possibly damaging 0.92
R3901:Mmp1a UTSW 9 7475345 makesense probably null
R4175:Mmp1a UTSW 9 7467235 missense probably benign 0.03
R5406:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R6462:Mmp1a UTSW 9 7467038 missense probably benign 0.01
R7016:Mmp1a UTSW 9 7465083 makesense probably null
R7039:Mmp1a UTSW 9 7465083 makesense probably null
R7098:Mmp1a UTSW 9 7475937 missense probably benign 0.00
R7144:Mmp1a UTSW 9 7475318 missense probably damaging 1.00
R7196:Mmp1a UTSW 9 7476017 nonsense probably null
R7284:Mmp1a UTSW 9 7465083 makesense probably null
R7289:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R7313:Mmp1a UTSW 9 7465083 makesense probably null
R7510:Mmp1a UTSW 9 7465083 makesense probably null
R7537:Mmp1a UTSW 9 7465083 makesense probably null
R7574:Mmp1a UTSW 9 7465083 makesense probably null
R7626:Mmp1a UTSW 9 7465083 makesense probably null
R7755:Mmp1a UTSW 9 7467004 missense possibly damaging 0.92
R7789:Mmp1a UTSW 9 7475265 missense possibly damaging 0.70
R7791:Mmp1a UTSW 9 7465083 makesense probably null
R7900:Mmp1a UTSW 9 7465083 makesense probably null
R8000:Mmp1a UTSW 9 7476214 missense probably benign 0.11
R8009:Mmp1a UTSW 9 7467235 missense possibly damaging 0.76
R8039:Mmp1a UTSW 9 7465083 makesense probably null
R8072:Mmp1a UTSW 9 7465083 makesense probably null
RF004:Mmp1a UTSW 9 7465083 makesense probably null
X0020:Mmp1a UTSW 9 7465626 missense probably damaging 1.00
Z1177:Mmp1a UTSW 9 7464230 missense probably benign 0.21
Z1177:Mmp1a UTSW 9 7467033 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGAAAACTACTACAACTTGGGC -3'
(R):5'- GGTGTCACATCACTCCAGACTC -3'

Sequencing Primer
(F):5'- TACTACAACTTGGGCAAAAACATG -3'
(R):5'- AGACTCTAAAGGCTCTCGCGATG -3'
Posted On2017-02-08