Incidental Mutation 'IGL02988:Cilp'
ID453496
Institutional Source Beutler Lab
Gene Symbol Cilp
Ensembl Gene ENSMUSG00000042254
Gene Namecartilage intermediate layer protein, nucleotide pyrophosphohydrolase
SynonymsC130036G17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02988 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location65265180-65280605 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGGG to TGG at 65280130 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]
Predicted Effect probably null
Transcript: ENSMUST00000048762
SMART Domains Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Mucin2_WxxW 55 139 1.9e-24 PFAM
TSP1 152 201 3.09e-10 SMART
low complexity region 233 242 N/A INTRINSIC
IGc2 321 383 4.45e-10 SMART
low complexity region 1154 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141382
SMART Domains Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Cilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Cilp APN 9 65278983 missense possibly damaging 0.80
IGL01340:Cilp APN 9 65275974 missense probably damaging 0.99
IGL02330:Cilp APN 9 65274522 splice site probably benign
IGL02729:Cilp APN 9 65278090 missense possibly damaging 0.63
IGL02833:Cilp APN 9 65277924 missense probably benign
IGL02961:Cilp APN 9 65278609 missense possibly damaging 0.88
IGL03137:Cilp APN 9 65278168 missense probably benign
IGL03211:Cilp APN 9 65280175 missense probably benign
IGL03301:Cilp APN 9 65280217 missense probably benign 0.01
IGL03341:Cilp APN 9 65278002 missense probably benign 0.07
ANU05:Cilp UTSW 9 65278983 missense possibly damaging 0.80
IGL02984:Cilp UTSW 9 65280130 frame shift probably null
IGL02991:Cilp UTSW 9 65280130 frame shift probably null
IGL03014:Cilp UTSW 9 65280130 frame shift probably null
IGL03050:Cilp UTSW 9 65280130 frame shift probably null
IGL03054:Cilp UTSW 9 65280130 frame shift probably null
IGL03055:Cilp UTSW 9 65280130 frame shift probably null
IGL03097:Cilp UTSW 9 65280130 frame shift probably null
IGL03098:Cilp UTSW 9 65280130 frame shift probably null
IGL03134:Cilp UTSW 9 65280130 frame shift probably null
IGL03138:Cilp UTSW 9 65280130 frame shift probably null
IGL03147:Cilp UTSW 9 65280130 frame shift probably null
R0096:Cilp UTSW 9 65273670 missense possibly damaging 0.57
R0219:Cilp UTSW 9 65269590 missense possibly damaging 0.64
R0347:Cilp UTSW 9 65280153 missense probably benign
R0699:Cilp UTSW 9 65270326 missense probably damaging 1.00
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1155:Cilp UTSW 9 65269587 missense probably benign 0.01
R1544:Cilp UTSW 9 65275845 missense probably benign 0.03
R1584:Cilp UTSW 9 65279715 missense probably damaging 1.00
R1586:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2055:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2069:Cilp UTSW 9 65278090 missense possibly damaging 0.63
R2070:Cilp UTSW 9 65279095 missense probably damaging 1.00
R2414:Cilp UTSW 9 65274645 splice site probably benign
R4284:Cilp UTSW 9 65278278 missense probably damaging 1.00
R4630:Cilp UTSW 9 65279880 missense probably benign 0.17
R4632:Cilp UTSW 9 65279880 missense probably benign 0.17
R4870:Cilp UTSW 9 65279698 missense probably damaging 1.00
R4908:Cilp UTSW 9 65278020 missense probably benign 0.17
R5568:Cilp UTSW 9 65280233 missense probably benign 0.04
R5621:Cilp UTSW 9 65278791 missense possibly damaging 0.71
R5889:Cilp UTSW 9 65280343 missense possibly damaging 0.93
R6645:Cilp UTSW 9 65279305 missense possibly damaging 0.66
R6878:Cilp UTSW 9 65279847 missense probably damaging 1.00
R6982:Cilp UTSW 9 65279805 missense probably damaging 1.00
R7330:Cilp UTSW 9 65280245 missense probably benign
R7967:Cilp UTSW 9 65278212 missense possibly damaging 0.80
R8305:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8306:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8307:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8308:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8386:Cilp UTSW 9 65279004 missense probably damaging 0.98
X0024:Cilp UTSW 9 65279643 missense probably damaging 1.00
X0025:Cilp UTSW 9 65279698 missense probably damaging 1.00
Z1088:Cilp UTSW 9 65280130 frame shift probably null
Z1176:Cilp UTSW 9 65280130 frame shift probably null
Z1177:Cilp UTSW 9 65280130 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTCCTCCAGAATCATGAAGAGC -3'
(R):5'- CAGCATCATGAGGCAGAGAC -3'

Sequencing Primer
(F):5'- CCTCCAGAATCATGAAGAGCAATGTG -3'
(R):5'- CATCATGAGGCAGAGACAGTAAG -3'
Posted On2017-02-08