Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL02988:Myo5a'

453497

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

IGL02988 (G1)

Quality Score

162

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 75130141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

AlphaFold

Q99104

Predicted Effect

probably benign
Transcript: ENSMUST00000123128

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

probably benign
Transcript: ENSMUST00000136731

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136871

Predicted Effect

probably benign
Transcript: ENSMUST00000155282

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159458

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110079O15Rik	A	G	1: 87,475,204		probably null	Het
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
Adgrd1	G	A	5: 129,144,010	A488T	probably benign	Het
AF529169	A	G	9: 89,602,739	S202P	probably benign	Het
Ano3	T	C	2: 110,775,010	S284G	probably damaging	Het
Aox2	G	T	1: 58,337,350	V897L	probably benign	Het
Arl6	T	A	16: 59,613,846		probably null	Het
Blnk	G	A	19: 40,929,216	T441M	probably damaging	Het
Casp8ap2	C	T	4: 32,644,590	T1221I	probably benign	Het
Cbll1	A	T	12: 31,492,172	F63L	possibly damaging	Het
Cdk14	A	G	5: 5,036,484	Y279H	probably damaging	Het
Cflar	A	T	1: 58,741,031	I265F	possibly damaging	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Cyp3a13	A	T	5: 137,899,010	Y347*	probably null	Het
Defa27	T	C	8: 21,315,567	S8P	probably damaging	Het
Depdc5	A	C	5: 32,956,167		probably null	Het
Dlg5	A	G	14: 24,166,255	F573S	probably damaging	Het
Fam20c	A	T	5: 138,755,994	E120V	probably benign	Het
Fam53a	T	C	5: 33,607,475	K296E	probably damaging	Het
Fcna	G	C	2: 25,630,681		probably benign	Het
Fndc1	T	C	17: 7,753,523	T1526A	possibly damaging	Het
Gm14325	A	C	2: 177,834,249		probably null	Het
Gm438	T	A	4: 144,786,530		probably benign	Het
Gm7582	G	A	1: 85,041,867		noncoding transcript	Het
Golga7b	A	C	19: 42,266,800	Y63S	probably damaging	Het
Hexb	A	G	13: 97,198,221	L14P	unknown	Het
Hsd17b3	A	C	13: 64,089,100	L10R	probably damaging	Het
Il6st	T	C	13: 112,498,886	F611L	probably damaging	Het
Ints13	T	A	6: 146,556,148	T411S	possibly damaging	Het
Kif18b	C	A	11: 102,908,320	C685F	probably damaging	Het
Kif5c	A	G	2: 49,619,717	N19S	probably damaging	Het
Lmbr1	G	T	5: 29,292,223		probably null	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mrc2	G	A	11: 105,325,571	R62Q	probably benign	Het
Myo1g	T	C	11: 6,508,183		probably benign	Het
Nobox	G	A	6: 43,305,161	S326L	possibly damaging	Het
Nsl1	C	A	1: 191,063,103	S22*	probably null	Het
Olfr1052	T	C	2: 86,298,479	I221T	probably damaging	Het
Olfr1469	A	C	19: 13,411,462	K298Q	possibly damaging	Het
Pdia3	T	A	2: 121,429,556	L192Q	probably damaging	Het
Pkd2	A	T	5: 104,503,605	R940*	probably null	Het
Plcd3	T	A	11: 103,076,742	Q458L	probably benign	Het
Polm	T	A	11: 5,836,343	T75S	probably benign	Het
Pon3	T	A	6: 5,232,330	D230V	possibly damaging	Het
Pxdn	A	T	12: 30,003,114	K917*	probably null	Het
Rad54l2	A	G	9: 106,700,585	S1046P	probably benign	Het
Rb1cc1	T	C	1: 6,247,811		probably null	Het
Rnf215	A	G	11: 4,136,785	E194G	probably damaging	Het
Rorb	A	T	19: 18,937,972	F441I	probably damaging	Het
Sel1l2	C	A	2: 140,248,588	G378V	probably damaging	Het
Sema6a	G	T	18: 47,298,214	A139D	probably damaging	Het
Serpinb3d	A	T	1: 107,078,536	M274K	probably benign	Het
Siglec15	A	C	18: 78,049,247	L32R	probably damaging	Het
Siglecg	A	T	7: 43,418,052	D681V	probably damaging	Het
Slc6a13	G	T	6: 121,326,107		probably benign	Het
Slc9b2	G	T	3: 135,318,418	A77S	probably benign	Het
Slit3	T	A	11: 35,708,063	V1498D	probably damaging	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Stxbp2	T	C	8: 3,633,267		probably benign	Het
Tbc1d9b	T	C	11: 50,151,946	S482P	possibly damaging	Het
Tec	A	G	5: 72,768,747	S321P	possibly damaging	Het
Tenm3	A	G	8: 48,235,346	M2402T	probably damaging	Het
Thrap3	G	A	4: 126,165,542		probably null	Het
Tm4sf1	A	T	3: 57,293,116		probably null	Het
Tmcc1	T	C	6: 116,042,928	E306G	probably damaging	Het
Traf3ip3	A	T	1: 193,194,874		probably null	Het
Utf1	C	T	7: 139,943,962	P30L	possibly damaging	Het
Wdfy3	A	T	5: 101,929,981	C880S	probably damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9040:Myo5a	UTSW	9	75174059	missense	probably benign	0.07
R9092:Myo5a	UTSW	9	75147132	critical splice donor site	probably null
R9249:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9274:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9293:Myo5a	UTSW	9	75180030	missense	probably benign	0.37
R9366:Myo5a	UTSW	9	75217518	missense	probably damaging	0.98
R9410:Myo5a	UTSW	9	75116214	missense	probably damaging	0.98
R9644:Myo5a	UTSW	9	75136349	missense	probably damaging	1.00
R9649:Myo5a	UTSW	9	75192444	missense
R9748:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9766:Myo5a	UTSW	9	75171632	missense	probably damaging	0.99
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- CGCACTGAAAGTCACTTTGATTTG -3'
(R):5'- AAAGCAGGTCCTTCTACAGTAGG -3'

Sequencing Primer
(F):5'- GTTTTCCAGGGATGAACGAAATC -3'
(R):5'- GCAGGTCCTTCTACAGTAGGATTTAC -3'

Posted On

2017-02-08