Incidental Mutation 'IGL02988:Hexb'
ID453511
Institutional Source Beutler Lab
Gene Symbol Hexb
Ensembl Gene ENSMUSG00000021665
Gene Namehexosaminidase B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02988 (G1)
Quality Score166
Status Validated
Chromosome13
Chromosomal Location97176331-97198357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97198221 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 14 (L14P)
Ref Sequence ENSEMBL: ENSMUSP00000022169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022169]
Predicted Effect unknown
Transcript: ENSMUST00000022169
AA Change: L14P
SMART Domains Protein: ENSMUSP00000022169
Gene: ENSMUSG00000021665
AA Change: L14P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glycohydro_20b2 35 157 7.1e-24 PFAM
Pfam:Glyco_hydro_20 179 496 1.2e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225592
Meta Mutation Damage Score 0.0957 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants exhibit spasticity, muscle weakness, rigidity, tremors, and ataxia beginning around 4 months of age and resulting in death about 6 weeks later. Mutants accumulate GM2 ganglioside and glycolipid GA2 in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Hexb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Hexb APN 13 97181929 missense probably damaging 1.00
IGL02010:Hexb APN 13 97176845 missense probably benign 0.01
IGL02126:Hexb APN 13 97178024 missense possibly damaging 0.93
IGL02303:Hexb APN 13 97176893 missense probably damaging 1.00
IGL02955:Hexb APN 13 97181076 utr 3 prime probably benign
R0311:Hexb UTSW 13 97183819 unclassified probably benign
R0470:Hexb UTSW 13 97177999 missense probably damaging 0.97
R0520:Hexb UTSW 13 97181110 missense probably benign 0.00
R0893:Hexb UTSW 13 97185627 missense probably benign 0.02
R1869:Hexb UTSW 13 97191259 missense probably benign
R2295:Hexb UTSW 13 97185612 missense probably damaging 1.00
R2884:Hexb UTSW 13 97183700 missense probably damaging 1.00
R4237:Hexb UTSW 13 97176751 intron probably benign
R4238:Hexb UTSW 13 97176751 intron probably benign
R4239:Hexb UTSW 13 97176751 intron probably benign
R4689:Hexb UTSW 13 97181092 missense probably damaging 1.00
R5166:Hexb UTSW 13 97182004 missense probably benign 0.13
R6665:Hexb UTSW 13 97179385 missense probably benign 0.01
R7379:Hexb UTSW 13 97181164 missense probably damaging 1.00
R7553:Hexb UTSW 13 97198173 missense probably benign 0.01
R8307:Hexb UTSW 13 97194199 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GATCCTTCTCTGTGCCCAAG -3'
(R):5'- TGCACAAACAAGTTCCTCAGGC -3'

Sequencing Primer
(F):5'- GAAACGCCTCCTGTAGCAG -3'
(R):5'- ACAAGTTCCTCAGGCGTGACAG -3'
Posted On2017-02-08