Incidental Mutation 'IGL02988:Il6st'
ID453512
Institutional Source Beutler Lab
Gene Symbol Il6st
Ensembl Gene ENSMUSG00000021756
Gene Nameinterleukin 6 signal transducer
SynonymsD13Ertd699e, gp130, CD130, 5133400A03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02988 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112464070-112510086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112498886 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 611 (F611L)
Ref Sequence ENSEMBL: ENSMUSP00000139227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070731] [ENSMUST00000183513] [ENSMUST00000183663] [ENSMUST00000183829] [ENSMUST00000184276] [ENSMUST00000184311] [ENSMUST00000184445] [ENSMUST00000184949]
Predicted Effect probably damaging
Transcript: ENSMUST00000070731
AA Change: F611L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064205
Gene: ENSMUSG00000021756
AA Change: F611L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 26 112 1.4e-30 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183513
SMART Domains Protein: ENSMUSP00000139016
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183663
AA Change: F611L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138836
Gene: ENSMUSG00000021756
AA Change: F611L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183829
SMART Domains Protein: ENSMUSP00000138987
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:1I1R|A 23 52 7e-8 PDB
FN3 56 142 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184276
SMART Domains Protein: ENSMUSP00000139060
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2.3e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184311
AA Change: F611L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139227
Gene: ENSMUSG00000021756
AA Change: F611L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184445
SMART Domains Protein: ENSMUSP00000139311
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184949
AA Change: F550L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138915
Gene: ENSMUSG00000021756
AA Change: F550L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 9.4e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 442 6.97e0 SMART
FN3 456 539 4.81e-4 SMART
transmembrane domain 557 579 N/A INTRINSIC
low complexity region 657 692 N/A INTRINSIC
Meta Mutation Damage Score 0.2804 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations show myocardial and hematological defects and die between embryonic day 12.5 and term. Conditional mutants show female infertility and neurological, cardiac, hematopoietic, immunological, hepatic, and lung defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Il6st
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Il6st APN 13 112481433 splice site probably null
IGL00571:Il6st APN 13 112487860 missense probably damaging 1.00
IGL01151:Il6st APN 13 112493651 missense probably benign 0.00
IGL01336:Il6st APN 13 112480239 missense possibly damaging 0.71
IGL01501:Il6st APN 13 112480059 missense probably benign 0.22
IGL01512:Il6st APN 13 112504366 missense probably benign 0.36
IGL01657:Il6st APN 13 112481543 missense probably damaging 1.00
IGL01863:Il6st APN 13 112504210 missense possibly damaging 0.88
IGL01916:Il6st APN 13 112480072 missense possibly damaging 0.90
IGL01978:Il6st APN 13 112497357 missense possibly damaging 0.51
IGL02089:Il6st APN 13 112495240 missense probably benign 0.12
IGL02752:Il6st APN 13 112480195 missense probably damaging 0.98
R0019:Il6st UTSW 13 112501148 missense possibly damaging 0.94
R0550:Il6st UTSW 13 112475114 splice site probably null
R0606:Il6st UTSW 13 112504272 missense possibly damaging 0.78
R1126:Il6st UTSW 13 112503732 missense probably damaging 1.00
R1452:Il6st UTSW 13 112481464 missense possibly damaging 0.79
R1581:Il6st UTSW 13 112481541 missense probably damaging 0.99
R1632:Il6st UTSW 13 112504332 missense possibly damaging 0.86
R1881:Il6st UTSW 13 112504413 missense probably damaging 1.00
R2013:Il6st UTSW 13 112498889 missense probably null 0.94
R2043:Il6st UTSW 13 112480219 missense probably benign 0.00
R2128:Il6st UTSW 13 112504175 missense probably benign 0.01
R2137:Il6st UTSW 13 112502858 missense possibly damaging 0.92
R3433:Il6st UTSW 13 112503831 missense probably damaging 1.00
R3696:Il6st UTSW 13 112504382 missense probably benign 0.13
R3697:Il6st UTSW 13 112504382 missense probably benign 0.13
R3698:Il6st UTSW 13 112504382 missense probably benign 0.13
R4172:Il6st UTSW 13 112495327 missense probably benign 0.25
R4543:Il6st UTSW 13 112481459 missense probably damaging 1.00
R4641:Il6st UTSW 13 112488530 missense probably damaging 1.00
R4838:Il6st UTSW 13 112490510 nonsense probably null
R4899:Il6st UTSW 13 112501161 missense probably damaging 1.00
R4922:Il6st UTSW 13 112502865 missense probably damaging 0.98
R5088:Il6st UTSW 13 112490555 missense probably damaging 1.00
R5104:Il6st UTSW 13 112488648 missense probably benign 0.02
R5853:Il6st UTSW 13 112481537 missense probably damaging 1.00
R6602:Il6st UTSW 13 112504413 missense probably damaging 1.00
R7082:Il6st UTSW 13 112504032 missense probably damaging 1.00
R7101:Il6st UTSW 13 112495373 critical splice donor site probably null
R7192:Il6st UTSW 13 112495207 missense probably benign 0.00
R7273:Il6st UTSW 13 112495298 missense probably benign 0.37
R7330:Il6st UTSW 13 112493651 missense probably benign 0.00
R7427:Il6st UTSW 13 112488560 missense probably benign 0.01
R7770:Il6st UTSW 13 112502804 missense probably damaging 1.00
R8086:Il6st UTSW 13 112494560 splice site probably null
R8307:Il6st UTSW 13 112487747 missense probably benign 0.16
U24488:Il6st UTSW 13 112494634 missense possibly damaging 0.90
Z1176:Il6st UTSW 13 112493618 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACAGATAAGTCAAATACTTTGGG -3'
(R):5'- CTGTACCGGATAAGCAAGCG -3'

Sequencing Primer
(F):5'- GGGTAAAAGAACTGTTGTTTCTCC -3'
(R):5'- GGATAAGCAAGCGTCCCTC -3'
Posted On2017-02-08