Incidental Mutation 'IGL02988:Arl6'
ID453513
Institutional Source Beutler Lab
Gene Symbol Arl6
Ensembl Gene ENSMUSG00000022722
Gene NameADP-ribosylation factor-like 6
Synonyms1110018H24Rik, BBS3, 2210411E14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #IGL02988 (G1)
Quality Score193
Status Validated
Chromosome16
Chromosomal Location59612949-59639391 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 59613846 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023405] [ENSMUST00000099646] [ENSMUST00000118438]
Predicted Effect probably null
Transcript: ENSMUST00000023405
SMART Domains Protein: ENSMUSP00000023405
Gene: ENSMUSG00000022722

DomainStartEndE-ValueType
ARF 1 185 1.62e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099646
SMART Domains Protein: ENSMUSP00000097238
Gene: ENSMUSG00000022722

DomainStartEndE-ValueType
ARF 1 185 7.35e-45 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118438
SMART Domains Protein: ENSMUSP00000113127
Gene: ENSMUSG00000022722

DomainStartEndE-ValueType
ARF 1 185 7.35e-45 SMART
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARF-like (ADP ribosylation factor-like) sub-family of the ARF family of GTP-binding proteins which are involved in regulation of intracellular traffic. Mutations in this gene are associated with Bardet-Biedl syndrome (BBS). A vision-specific transcript, encoding long isoform BBS3L, has been described (PMID: 20333246). [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a disorganized photoreceptor inner segment and craniofacial abnormalitries. Male mice are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Arl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02390:Arl6 APN 16 59621217 splice site probably null
IGL02976:Arl6 APN 16 59623896 missense probably damaging 1.00
shrunk UTSW 16 59623894 missense probably damaging 1.00
slunk UTSW 16 59623092 missense possibly damaging 0.54
R0147:Arl6 UTSW 16 59618790 unclassified probably benign
R0390:Arl6 UTSW 16 59622421 intron probably benign
R2011:Arl6 UTSW 16 59624313 missense probably damaging 0.97
R2138:Arl6 UTSW 16 59622467 intron probably benign
R2997:Arl6 UTSW 16 59623876 critical splice donor site probably null
R4445:Arl6 UTSW 16 59624313 missense probably damaging 0.97
R4677:Arl6 UTSW 16 59618865 splice site probably null
R6004:Arl6 UTSW 16 59623894 missense probably damaging 1.00
R6251:Arl6 UTSW 16 59618806 missense probably damaging 0.99
R7171:Arl6 UTSW 16 59623092 missense possibly damaging 0.54
R7760:Arl6 UTSW 16 59618806 missense probably damaging 0.99
R7768:Arl6 UTSW 16 59632336 missense probably damaging 1.00
R8342:Arl6 UTSW 16 59622439 missense unknown
Predicted Primers PCR Primer
(F):5'- AACGTTCTTCCAGAGTCCACC -3'
(R):5'- GAGGAACTGCTCCCTGTCTTTC -3'

Sequencing Primer
(F):5'- GTTCTTCCAGAGTCCACCAAAGC -3'
(R):5'- GAACTGCTCCCTGTCTTTCTAATAAG -3'
Posted On2017-02-08