Incidental Mutation 'IGL02988:Siglec15'
ID453517
Institutional Source Beutler Lab
Gene Symbol Siglec15
Ensembl Gene ENSMUSG00000091055
Gene Namesialic acid binding Ig-like lectin 15
SynonymsCd33l3, EG620235
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02988 (G1)
Quality Score185
Status Validated
Chromosome18
Chromosomal Location78043614-78057395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78049247 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 32 (L32R)
Ref Sequence ENSEMBL: ENSMUSP00000126901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170760]
Predicted Effect probably damaging
Transcript: ENSMUST00000170760
AA Change: L32R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126901
Gene: ENSMUSG00000091055
AA Change: L32R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 49 165 8.51e-7 SMART
SCOP:d1wwca_ 167 258 8e-10 SMART
Blast:IG_like 171 254 1e-47 BLAST
transmembrane domain 260 282 N/A INTRINSIC
Meta Mutation Damage Score 0.3162 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired osteoclast differentiation and function and mild osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Siglec15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Siglec15 APN 18 78043605 unclassified probably benign
IGL02472:Siglec15 APN 18 78043617 missense possibly damaging 0.72
PIT4377001:Siglec15 UTSW 18 78057375 start gained probably benign
R0040:Siglec15 UTSW 18 78048877 splice site probably benign
R0607:Siglec15 UTSW 18 78046137 missense probably benign 0.03
R4427:Siglec15 UTSW 18 78043621 missense possibly damaging 0.53
R5023:Siglec15 UTSW 18 78048675 missense probably damaging 1.00
R5994:Siglec15 UTSW 18 78047375 missense probably damaging 1.00
R7052:Siglec15 UTSW 18 78048731 missense probably damaging 1.00
R7807:Siglec15 UTSW 18 78047481 missense probably damaging 1.00
R7827:Siglec15 UTSW 18 78057230 nonsense probably null
R7898:Siglec15 UTSW 18 78043699 missense probably benign 0.19
R8052:Siglec15 UTSW 18 78048588 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AAGCATCTCCCTAGCTGTGC -3'
(R):5'- AATCACAGCTTCATGCCTTTAGGG -3'

Sequencing Primer
(F):5'- TGTGCTCCCCCATAACTAAAAGGATG -3'
(R):5'- AGGGCGTTCTAATACAGGCTC -3'
Posted On2017-02-08