Incidental Mutation 'IGL02988:Blnk'
ID453520
Institutional Source Beutler Lab
Gene Symbol Blnk
Ensembl Gene ENSMUSG00000061132
Gene NameB cell linker
SynonymsBASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #IGL02988 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40928927-40994535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40929216 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 441 (T441M)
Ref Sequence ENSEMBL: ENSMUSP00000112473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]
Predicted Effect probably damaging
Transcript: ENSMUST00000054769
AA Change: T444M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: T444M

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 345 436 3.07e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117695
AA Change: T441M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: T441M

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 342 433 3.07e-19 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Lmbr1 G T 5: 29,292,223 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Blnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Blnk APN 19 40934446 missense probably benign 0.15
IGL01286:Blnk APN 19 40934506 missense probably benign 0.00
IGL02090:Blnk APN 19 40934485 missense probably benign 0.38
IGL02814:Blnk APN 19 40962429 missense probably damaging 1.00
IGL02831:Blnk APN 19 40962429 missense probably damaging 1.00
IGL03024:Blnk APN 19 40994002 splice site probably benign
Augen UTSW 19 40929291 missense probably damaging 1.00
Blick UTSW 19 40934459 missense probably damaging 1.00
busy UTSW 19 40952391 nonsense probably null
There UTSW 19 40952390 missense possibly damaging 0.94
R0140:Blnk UTSW 19 40940224 missense probably damaging 0.99
R0671:Blnk UTSW 19 40937667 nonsense probably null
R1617:Blnk UTSW 19 40962363 missense probably benign
R1638:Blnk UTSW 19 40937678 missense probably benign
R1803:Blnk UTSW 19 40952377 missense probably damaging 0.96
R1970:Blnk UTSW 19 40940165 splice site probably benign
R2880:Blnk UTSW 19 40962455 missense probably damaging 1.00
R2980:Blnk UTSW 19 40962350 missense probably damaging 1.00
R5421:Blnk UTSW 19 40968523 missense probably damaging 1.00
R5987:Blnk UTSW 19 40929289 missense possibly damaging 0.95
R6321:Blnk UTSW 19 40934459 missense probably damaging 1.00
R6703:Blnk UTSW 19 40962506 splice site probably null
R6970:Blnk UTSW 19 40962377 missense probably damaging 0.99
R7101:Blnk UTSW 19 40972638 missense probably benign 0.01
R7432:Blnk UTSW 19 40959857 nonsense probably null
R7560:Blnk UTSW 19 40952390 missense possibly damaging 0.94
R7797:Blnk UTSW 19 40959788 missense possibly damaging 0.51
R8287:Blnk UTSW 19 40929291 missense probably damaging 1.00
R8473:Blnk UTSW 19 40952410 missense possibly damaging 0.81
R8798:Blnk UTSW 19 40962351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAAGCTCGTGTGAACGCC -3'
(R):5'- TGTCACTTGAGCCCCAGTAAC -3'

Sequencing Primer
(F):5'- TCGTGTGAACGCCCTAGGAAG -3'
(R):5'- TTGAGCCCCAGTAACCATGAAC -3'
Posted On2017-02-08